SimpleSearch - Line and FST details


Line specific information

 
Line ID 570H02
Vector Used pAC161
Line Availability only available from NASC (N454710)
Segregation Analysis 50:35:29
Confirmed for Hit At4g18020
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g18020

 
Sequence (A. th genome BLAST matches underlined)
>16-K021262-022-570-H02-8409
GNAGCCATTTACAATTGAATATATCCTGAAGACACTTCAACACTATACAATTTTTCACAC
ATTATTAGTAAATATTCATCAGGTGTGTGCACTATTGATGAAATAAGAATAATTCATGAG
GAACTTGATTTTGTTATTTATAAAGAGTGGACCACCATGCCATGAAATCTAACAAAGCTT
TTGAATCATTTAAGAGTGAATATATTATTAGTTTAGTGTTGTTTAACTCGTGCATGCAGT
GATTAGTTAACTTAACAACACAGACTAATGACCTTTAACAAATACTAAAACATAGGCTTA
TGACAACTAATGAAGGAGAAAGGCAAATCCCTATGGGATCCTCCCTATAGTGAGACTTAT
GAATCCTCCCTATANTGAAATAATGTGAAATTCTACCTCCTTATCTCACTACCATCCTAT
CTAAATCCAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTAG
AGGCGAAAGCAATAAACAAA
GenBank Accession BX652589 [GenBank]
Graphic View Graphic view of gene At4g18020
Predicted Position of Insertion Chr4:10006828 - go to primer design
BLAST e Value 2e-137
Hit Clone Code (BAC ID) T6K21
Hit Gene Code At4g18020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CheY-like two-component responsive regulator family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40