SimpleSearch - Line and FST details


Line specific information

 
Line ID 574D07
Vector Used pAC161
Line Availability only available from NASC (N455051)
Segregation Analysis 50:47:34
Confirmed for Hit At5g35110
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g35110

 
Sequence (A. th genome BLAST matches underlined)
>52-K021121-022-574-D07-8409
GNAGCCATTTACATTGAATATATCCTGAAACTACTATTTCTGCATGGCTATAAAAAAAGA
ATCTCTATGGGATCCTCCCTATAGTGAGACTTATTGATCCCCCCTTTGGAGGGGAATGGG
GATACTCTAAATTGTGGGGTCAATGTTAATTTTTAAAAGTGGGGGAATCTGGTTTTTCCC
CTGACCTTTTGCCCATGGGGGGGGGGGGGGGGGATGNNAAAACCNNTTTATTTCCCCCCA
AAATTACTTATTTCC
GenBank Accession BX652949 [GenBank]
Graphic View Graphic view of gene At5g35110
Predicted Position of Insertion Chr5:13364467 - go to primer design
BLAST e Value 9e-04
Hit Clone Code (BAC ID) F7N22
Hit Gene Code At5g35110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03