SimpleSearch - Line and FST details


Line specific information

 
Line ID 580A05
Vector Used pGABI1
Line Availability only available from NASC (N455589)
Segregation Analysis 50:47:30
Confirmed for Hit At5g24520
Parent of DUPLO pair none
Parent of pair(s) 6959, 8089

Gene hit At5g24520

Sequence (A. th genome BLAST matches underlined)
>33-K021290-022-580-A05-8409
GCAGATAGATTCCATTGAGAGCTGATCCGTGTGCACCTTCCCCCCGACAAGGTGAGCGAC
CGGGGCAACTAAATGATCCACGTGGAACCTTAAGACATCGTCCGTCCGATGGCGTTGCAA
GAAACTCGATCTAACCTTGACATCAACCTACGCGCCGCGCATGCGCGCCACAATATCGCT
TCTTATTTGAACGCATGTATGGAATCCTCCCTATGATTGAGACAGTCAGATTTTTCAAGA
GACGGATAAATAATCAATGGAGACGGCGTACATATAAACCCTCTGGATTATTCAGTATCT
TTTAATGTATCTATTGATAATGGGCTTCTGTATATTCAGATAATGGGCCTTTTACTTTAA
CGTTAAGAGCTATAGAATGGCCTAATTATTGGATCACTAGGATGACATGAAACACTAACA
ACATTAATATGTGACACTC
GenBank Accession BX653443 [GenBank]
Graphic View Graphic view of gene At5g24520
Predicted Position of Insertion Chr5:8372531 - go to primer design
BLAST e Value 1e-107
Hit Clone Code (BAC ID) T31K7
Hit Gene Code At5g24520 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Appelhagen et al. 2014, ttg1-21]


Last Updated on 14.10.2014 10:23