SimpleSearch - Line and FST details


Line specific information

 
Line ID 588F03
Vector Used pGABI1
Line Availability only available from NASC (N456415)
Segregation Analysis 50:48:36
Confirmed for Hit At5g56610
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g56610

 
Sequence (A. th genome BLAST matches underlined)
>22-K021380-022-588-F03-8409
AGCCATTTACATTGAATATATCCTGGCGATGACCGATGAAACGGAGGAAGATGACACGAC
GCAGCAGCGATCATCACGAAACGACGGCGTTTCAAAGAATAAGGGTAAGGGTTTTAAGGG
AGATAAAGCAAAGAGGGCTCTAATCGGAGCTGGTGGTCGGATCCTTTTTTACCCAACTCT
TTTGTATGGGATCCTCCCTATAGTGAGAT
GenBank Accession BX655317 [GenBank]
Graphic View Graphic view of gene At5g56610
Predicted Position of Insertion Chr5:22916734 - go to primer design
BLAST e Value 1e-86
Hit Clone Code (BAC ID) MIK19
Hit Gene Code At5g56610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphotyrosine protein phosphatases superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03