SimpleSearch - Line and FST details


Line specific information

 
Line ID 588F08
Vector Used pGABI1
Line Availability only available from NASC (N456420)
Segregation Analysis 50:47:27
Confirmed for Hit At1g75640
Parent of DUPLO pair 2391
Parent of pair(s) none

Gene hit At1g75640

 
Sequence (A. th genome BLAST matches underlined)
>62-K021380-022-588-F08-8409
AGCCATTTACAATTGAATATATCCTGTTTTTTTAATAACTCAACCAAAAGGGTTGTAATT
GGTTTTGTGCCTTCACACAAGATTTTGTGACAAAAGATGCTTACTTTGTCAAACCCTGTT
CATCGCTTATACACTTCAGCGTAACCGGTAATCACCTCACCGGTTTAATTCCGGTTACTT
TAGGCACGATTCGAAGCCTGCAGGTGATTTCATTATCGGAGAATTCATTTACCGGTATGG
GATCCTCCCTATAGTGAGACGGTATGGGAACCCCCCTAAAAT
GenBank Accession BX655321 [GenBank]
Graphic View Graphic view of gene At1g75640
Predicted Position of Insertion Chr1:28406402 - go to primer design
BLAST e Value 7e-63
Hit Clone Code (BAC ID) F10A5
Hit Gene Code At1g75640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich receptor-like protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03