SimpleSearch - Line and FST details


Line specific information

 
Line ID 589A06
Vector Used pAC161
Line Availability only available from NASC (N456454)
Segregation Analysis 12:8:6
Confirmed for Hit At1g76860
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g76860

 
Sequence (A. th genome BLAST matches underlined)
>41-K021767-022-589-A06-8409
GNAGCCATTTACAATTGAATATATCCTGGAGATGAATGATTAGAATTGTTCACATGCATT
GGATGATACTCTATATCAGACGAATTGCATGCTTGTAGGAAGGGCTTGGCTGCCCCGGAA
TCATCACGAAGTCGGCTGCCTTGATCGCGGACACAGCCAAGTCCGCCGCCTGGGGCGCTC
CCTCTATCACTACAAATTCCCGCCGGCCGATGACCTTCTCCTCACACTCAATCTTATATC
CTACACAAATCTTATTGTTCTGGAAGATATAATCTATTGGATCCAAATTATGAAGGCCTT
TCCATGTAACTGACTGTTTCTATGGGATCCTCCCTATACTGAG
GenBank Accession BX655369 [GenBank]
Graphic View Graphic view of gene At1g76860
Predicted Position of Insertion Chr1:28855111 - go to primer design
BLAST e Value 3e-31
Hit Clone Code (BAC ID) F7O12
Hit Gene Code At1g76860 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Small nuclear ribonucleoprotein family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23