SimpleSearch - Line and FST details


Line specific information

 
Line ID 589H11
Vector Used pAC161
Line Availability only available from NASC (N456543)
Segregation Analysis 50:50:48
Confirmed for Hit At4g05540
Parent of DUPLO pair none
Parent of pair(s) 68954, 97325

Gene hit At4g05540

 
Sequence (A. th genome BLAST matches underlined)
>88-K021428-022-589-H11-8409
ATTCCCCCGATTCCTAGAACAAGCAGATTGCTCTGTATCCTGGAATATTTAAAACGAGAG
CCACAGTTACTCCACATTAGACGCTAAAGCCAGATCATTTGATGTTTACTTACCGCGGAA
TTTGCTTGAAGGACACTCGTGATGAGACTCACGTTTCCATCTCCGTTGTGCAAAGCCCTC
CAGATACGAGTGTTTGAGCCTACGCTATATAAAAAAAAAACCCGTAACGAAACGAATATT
GCTCATCAATGGATATAGATTTAGAGGAATGAACAGAGAAATGTAGCTCATCTCCAACAG
AGAACACATACGCAAGAATCAGTGGGTTTAAGTCATCCACGTTTCCTTGTGACTCCAATG
AGATCTCCATGTTTCGGCTCGTAGTTAGTTCTATTTCCTTGTGCAACACTCGTAAGTATG
GGATCCTCCCTATAGTGAG
GenBank Accession BX655589 [GenBank]
Graphic View Graphic view of gene At4g05540
Predicted Position of Insertion Chr4:2820651 - go to primer design
BLAST e Value 5e-169
Hit Clone Code (BAC ID) T1J24
Hit Gene Code At4g05540 [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX655591 [GenBank]

Gene hit At5g01770

 
Sequence (A. th genome BLAST matches underlined)
>88-K021381-022-589-H11-8409
AGCCATTTACATTGAATATATCCTGCCACCGCTGCCACTTTATACCCGGTGGAGCTTGCA
TGTTGGTTTCTACCCAAAAGTGAACCCGTTAGGCAGATAATTTCCATTGAGAATTGATCC
GTGTGCACCTTCCCCCCAACATGGGGAGCGACGGGGCAACCGAATGATCCACATGGGACT
TTTAAACATCATCCGTCGGATGGCGTTGCTAGAGAATCAGTCTATCCGTGAGATCAGCCG
AAGCACCGGGGAGGCGCGCAAGACAATCGCGAAGTATTTGAACGCAGGTATGGGATCCTC
CCTATAGTGAGACCCTGCGGGTAACAACATCGGGTAGGGATGAAAGGCTAGGCAGCCGAG
TGGGCCAATCTGCTGGCCCAGCAGGAAGAGTGGTATGGGATCCCCGCAAAGAGAGGGTCA
GACAGCACGACCCATACCATAAAAAAAATTCAGTCAAGGAACAGGGAAAGTTTTTAGCGA
ACAAATGCCTTTCTAA
GenBank Accession FR812735 [GenBank]
Graphic View Graphic view of gene At5g01770
Predicted Position of Insertion Chr5:294320 - go to primer design
BLAST e Value 4e-09
Hit Clone Code (BAC ID) T20L15
Hit Gene Code At5g01770 [TAIR] [MIPS] [SIGnAL]
Gene Annotation HEAT repeat ;WD domain, G-beta repeat protein protein
Insertion Classification TS2TE (3')
Confirmation Status unknown
Other FSTs Supporting this Hit BX655590 [GenBank]


Last Updated on 14.10.2014 10:23