SimpleSearch - Line and FST details


Line specific information

 
Line ID 592B03
Vector Used pAC161
Line Availability only available from NASC (N456751)
Segregation Analysis 38:38:37
Confirmed for Hit At3g27080
Parent of DUPLO pair none
Parent of pair(s) 3425, 3427

Gene hit MLE2

 
Sequence (A. th genome BLAST matches underlined)
>18-K021782-022-592-B03-8409
NNNNNGGCAGAATCCGGACATGAGCCTTTACATTGAATATATCCTGCATTGAGCAACTTA
TTTTCCATACAATGAAATCGGCTCCCTAAGGCCAGTTGACAAATTAATTCCAAGAATCGC
AGAATATCCAACATTTTGAACCACACTGCTGGAAGCGCTATTTTCTTATACACTACAGAT
CAAAGACTTATCACACACACACCACATCTGAACTACGTACAAATAATTGAAAATCATATA
ATCTCACTCCAATTTCTTGTTATTATTTGAGTTCAAGTAGTACTATGAGAACCCCCATAT
AGTGAGTGAATTGAAGAGTAAACAAAGGTACGCATCTTTGACCTTTCACACTCGATATAG
AAAGGACAGGCTGTGACTTAATGTTGGGTACACAGTTAGTAACTCAATTCCCTATGGGAT
CCTCCCTATAGTGAG
GenBank Accession BX653830 [GenBank]
Graphic View Graphic view of sequence BX653830 of line 592B03
Predicted Position of Insertion Chr5:25399230 - go to primer design
BLAST e Value 7e-97
Hit Clone Code (BAC ID) MLE2
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g27080

 
Sequence (A. th genome BLAST matches underlined)
>18-K021769-022-592-B03-8409
GNAGCCATTTACAATTGAATATATCCTGCAGGAACCAGATAATATTCACTACCTGAAATC
ACGCGAAATGACGGCCAAGGTACTTCTTTCTATAGACCATCAACCAATTTGTGTTCATAT
TCATTTTGCCGCTGAACCCAATCTCAAAGTTTTATTCTTTGATCAAATTTCTTCTCCTTT
GTGCTGAATACAGGCTCCACAGCTGCACGCAAAAACTTAAAAACCACGCTTAAGCTCACA
GCCAATGGGTCACGTTGAATCTCCAGCACCGCCGAGCTCAAAGGTTCTCTCTTTTTTATT
TATGTTCATTCTCATCATCACATTTCATTTTCATTGCTTGATGTAATCGACTTGTAGATA
ATATAAGAAGATGTGTTTGAACCTCATGATCATATTTTGATGTATTGTTCCAAACACAGG
CAGTGAAGAATAAGAAAAGTAGTGATGCCAAGTATGATGCTATGGGTTGGGTGATTCTAT
GGGATCCTCCCTATAGTGAGTATAAGAAAAGAAAGAGATAGAGAGATGTG
GenBank Accession BX653829 [GenBank]
Graphic View Graphic view of gene At3g27080
Predicted Position of Insertion Chr3:9985730 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MOJ10
Hit Gene Code At3g27080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation translocase of outer membrane 20 kDa subunit 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40