SimpleSearch - Line and FST details


Line specific information

 
Line ID 592D11
Vector Used pAC161
Line Availability only available from NASC (N456783)
Segregation Analysis 50:49:34
Confirmed for Hit At5g35770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g35770

 
Sequence (A. th genome BLAST matches underlined)
>84-K021769-022-592-D11-8409
GNAGCCATTTACAATTGAATATATAGTAGATGTTTCTCTGTCTCTCTCATCCCTCTCCAC
AATCCGTGGACCTACATTCTCTACATTTACGTTTATATTGTTATTTATTGTACATCTTTA
TTCCTCATTAAACGCAAAGTAATGTATTTGACTTCGTACTCTATGGGATCCTCCCTATAG
TGAGACGTATTACTCACTCCTTTAAACGAGATTGTTGACTCCCCGAATTACAGATGTTCG
AGGTCTAATAAATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCATCGTA
TTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTC
TACATTCACGTCCAAATGGGTGAGTAGTACGACTCACTATAGGGAGGATCCCNTAGCTCT
CTATA
GenBank Accession FR812774 [GenBank]
Graphic View Graphic view of gene At5g35770
Predicted Position of Insertion Chr5:13938178 - go to primer design
BLAST e Value 2e-72
Hit Clone Code (BAC ID) MXH1
Hit Gene Code At5g35770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40