SimpleSearch - Line and FST details


Line specific information

 
Line ID 593B09
Vector Used pAC161
Line Availability only available from NASC (N456853)
Segregation Analysis 50:49:43
Confirmed for Hit At2g18570
Parent of DUPLO pair none
Parent of pair(s) 89604, 89607, 89609, 89610

Gene hit At2g18570

 
Sequence (A. th genome BLAST matches underlined)
>66-K021827-022-593-B09-8409
CCACCGTCTTAGTGATTATTGTATCTTCTGGCTCCACGAGGTTGTCTGCATCCACCGAGG
AGAATATCCGTAATTTGACAGATTGTTCTAACCGCGGCTGCGTGTATGGCGTCGGTTTCG
GTCGGTGAATAGGAGCCGGAGGTGACCGCGAGAATGGTGACGTGGATGTTTAGGACGGAG
GAGAGACGGTTGCCGAGCTCCAGGATAGGGATGAGGTGACCCAAGCCAGGGCTATGGGAT
CCTCCCTATAGTGAGAAAAAATGAAAAAGTACTTACCTTATTTTTTTTCTATTCACAAAG
GTGTATGGCCGCAACGTTATTATAAGTCACGAGGACACACTCTCGCTGAGCTCAGAAAAG
GACGAATATTTGAACCGGGCCATGTAATTACTTGGTTTATCATTCTGGGAACATTGTTAT
GACTAGATATCATGTT
GenBank Accession BX653925 [GenBank]
Graphic View Graphic view of gene At2g18570
Predicted Position of Insertion Chr2:8063737 - go to primer design
BLAST e Value 3e-96
Hit Clone Code (BAC ID) F24H14
Hit Gene Code At2g18570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03