SimpleSearch - Line and FST details


Line specific information

 
Line ID 593C11
Vector Used pAC161
Line Availability only available from NASC (N456867)
Segregation Analysis 50:44:36
Confirmed for Hit At4g36180
Parent of DUPLO pair 2391
Parent of pair(s) none

Gene hit At4g36530

 
Sequence (A. th genome BLAST matches underlined)
>83-K021827-022-593-C11-8409
ATTCTGATCTATGGGGATCCTCCGCAAAGGGAGACGTAGAACTCGCCGGTTTTAGATGTG
ACTGAATAACCGCCATAGTCTCTACGCCATAAAGAGCGCAACATTCAGAAACACTCTGCT
TCGTCGAGCGGATTCGACTTGTCTGGCTCAGGGGTCGCCACAACTCTCCCGCAAGTTCAC
ACATACACTCGGTGCTCAAAAAGTTTGACCTTTTTGCATCTCTCAATTCTGAAATATCTG
GTTCTCTTGTCCTTGAAAATTTTACGAGGTTGTTCTCTGTGAATAATCGATGTCTGCTTC
ATGTGCTTTAACACCATCTGTTAGGACAGAATTATTCAGTTCAGCGTCCTCGAAAAGATC
AATCTTTCC
GenBank Accession BX653943 [GenBank]
Graphic View Graphic view of gene At4g36530
Predicted Position of Insertion Chr4:17242068 - go to primer design
BLAST e Value 1e-132
Hit Clone Code (BAC ID) AP22
Hit Gene Code At4g36530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At4g36180

 
Sequence (A. th genome BLAST matches underlined)
>83-K021829-022-593-C11-8409
CCGGACAGAAGCCATTTACACTTGAATATCTGCGGCACAGGTCTTTAACATTTATTGTGT
TCGGATTGTGTTTATCGTTGTCGGATGGCAACAGCCCCTCCGGGTGCGGAAGAGCACCGT
ACGCGGCGGGAATCACGCCGCCGATTTCGTTCTCCGACGCGCTCAAGTGAACTAAGGAGG
AGCAGTTTGAGATAGCAGACGGTAATGTTCCTTGCAAGAGATTGAAATCAAGCCATAAGT
ACTGAAGACTTTGGAGGTTACCTATGGGATCCTCCCTATAGTGAGACNNNNTNNNCNCGC
NNNTNNNNNNNNNNNNNNNNNTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAA
AAGGAACGTACCTTTTGAGGAAACGACTGATTACGATCCGTCGTAGTGAAAGGCGAAAGC
AATAAGCAAGTTGTTCTAATTCGGAAATCTTTATTTCGACGGGACGAAGTTCGCGGCGAA
ATGGGAGAATAAGAGGACCCCCNAAAAAGAAGACGAAGGGGA
GenBank Accession BX653944 [GenBank]
Graphic View Graphic view of gene At4g36180
Predicted Position of Insertion Chr4:17122860 - go to primer design
BLAST e Value 2e-84
Hit Clone Code (BAC ID) F23E13
Hit Gene Code At4g36180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich receptor-like protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03