SimpleSearch - Line and FST details


Line specific information

 
Line ID 595D12
Vector Used pAC161
Line Availability only available from NASC (N457072)
Segregation Analysis 50:31:26
Confirmed for Hit At3g12100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g12100

 
Sequence (A. th genome BLAST matches underlined)
>92-K021862-022-595-D12-8409
GNAGCCATTTACAATTGAATATATCCTGTGGCATCCTCCCAACAGTGAGGACACGAGCAT
ACCTAGTAGGTTCACCAGCAGATTTGTTACCGCTGATAACCGACGATGTAATTTCCGACG
AGAAATAACCGACGATGATAAACATACCAATATTGACACGAGCATAATTCCGGAAAAACC
AAACACCTATGGGATCCTCCCTATAGTGAGACACAGCAGACACAATCAAATAATGCCTAC
ATAAAGGAAATCTCAGTAAATCACACTACTGAAAGGAACAAGAGGGAACAAGTACTGTAA
ACTTAGTAAGTGCTAGAGATATATATAGAAACTCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX654140 [GenBank]
Graphic View Graphic view of gene At3g12100
Predicted Position of Insertion Chr3:3855835 - go to primer design
BLAST e Value 2e-63
Hit Clone Code (BAC ID) T21B14
Hit Gene Code At3g12100 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cation efflux family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX654139 [GenBank]


Last Updated on 14.10.2014 10:23