SimpleSearch - Line and FST details


Line specific information

 
Line ID 596B04
Vector Used pAC161
Line Availability only available from NASC (N457136)
Segregation Analysis 50:47:41
Confirmed for Hit At2g05715
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g23380

 
Sequence (A. th genome BLAST matches underlined)
>26-K025556-022-596-B04-8409
TAATTGCCCCACACCTTAGACTTATCTTTGTCTCCAGAGTTTCAACGTGCCCGAAAGAAA
AGCACACACAAAACAAAACCCATCAAGGGAAAAATAGCTATGGAAATGAAACTTGTAGCT
ATGGGATCCTCCCTATAGTGAGAGCTATGNCATCCTCCCTATANTGAGANNNCTTACATC
CTCCCTCTATTGAAAAAAATTACATAACCTCCCCACTATTANACTCCTCTTATCCTCCCT
ATAATTACACTCTTTAATACCCCTCTAANAANATANNANTCTTCTCTTCCATATTAATTA
ATAATTTATTCTCTCTNCATTTTATTTCAAATCTATATTTTAAATATAAAATTATTTACA
TCCAATTTTTTTTTTTAATTATACCNTAAAATCTCNTTAATTTTTATTAATAANTACATT
ATTAATTTTATTTTTTTTCATTATATAATATACTTTATAATATTTTTTCAAAAAAAAACT
TTACATAATAATTTTATTTATAATTAACAAAAAATTC
GenBank Accession CR356335 [GenBank]
Graphic View Graphic view of gene At1g23380
Predicted Position of Insertion Chr1:8301291 - go to primer design
BLAST e Value 6e-48
Hit Clone Code (BAC ID) F26F24
Hit Gene Code At1g23380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein knotted-1-like 6
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At2g05715

 
Sequence (A. th genome BLAST matches underlined)
>26-K025557-022-596-B04-8409
ACAGGAGATACTCTCAGGTTCATATGGAATTTATGACAAGTTTCAGTTTGGTTTTATCAG
ATTCTTGTATTGGTTTTAGGCTTCAGCTGCAAGATGTTTGTGTTTCTTATGTATTAGTTG
GTTACTCTAATGGTGCAAGTAGATTTGAATAGAGCAGGTGTTCTTGAACATGATCTGAGA
ATTGGTATAGATGCTGCTGAATACGCTTGTGAAATGCAACAGATTGCGAGGTCTTTGGGA
GTCAGTAATGGGAATATGCAAGAAGGCTCTCTTATTCCTTTTCAAAAACAATAATATTCA
ACTCTTGCAAGTTGCGAAACATGGGAGCCTAAGCGTGTAAGAATAACCCACTGAAACTCA
TATATTGCATGAGATCACTCACCTTTTAACCTAATCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession CU589780 [GenBank]
Graphic View Graphic view of gene At2g05715
Predicted Position of Insertion Chr2:2146841 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T3P4
Hit Gene Code At2g05715 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03