SimpleSearch - Line and FST details


Line specific information

 
Line ID 597G03
Vector Used pGABI1
Line Availability only available from NASC (N457291)
Segregation Analysis 50:26:16
Confirmed for Hit At1g49530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g49530

 
Sequence (A. th genome BLAST matches underlined)
>23-K025558-022-597-G03-8409
NNTTTCGTCGTAATTCCGGACATAAGCCATTTACAATTGAATCTTATCCGCACTATAGTT
AGAGATGATGATAACTTGATATATATTCTATGGAATCCTCCCTATTTTGTGTCGCATCCA
ACATATCCAGCGAGAGACTACACAGGAACCACCTTGTCATAATCACACCCCTGAAGATGT
TCCTGCGCTTCTCTGTTCAACCTCTTTGCATATTCTCTCGCATTGTCCACACCCATCACC
TTCGGATACGTCAGCTTTCCGGTGATCAAATCTTTACCGGCAGTTTTCCCAAGCTCCTCG
GAAGACTTGGTCTCATCGAGTACATCATCCATCACCTGAAACATCAGTCCAACGCACCTC
GCGTAGCTCTTAAGCCTCTCAATCTCTTCATCAGACCCACCTCCCATTATAGCTCCCACA
ACAGCCGCAGCTTCAACCAAAACCGCGGTTTTATGAACATGCATCAACTCAAGATATCTC
AATTCGTCGTCTTCGTTCTTAAAACTCATCCTTTCTCCGGCCAAATCCGCTGCTTGACCT
GC
GenBank Accession CR356530 [GenBank]
Graphic View Graphic view of gene At1g49530
Predicted Position of Insertion Chr1:18333582 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13F21
Hit Gene Code At1g49530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation geranylgeranyl pyrophosphate synthase 6
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR356531 [GenBank]


Last Updated on 31.08.2016 09:40