SimpleSearch - Line and FST details


Line specific information

 
Line ID 600G05
Vector Used pAC161
Line Availability only available from NASC (N457581)
Segregation Analysis 50:46:28
Confirmed for Hit At2g43570
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F14D17

 
Sequence (A. th genome BLAST matches underlined)
>39-K023925-022-600-G05-8409
CCCGAGTGATCCCCTGGTCCGCTGTCCCCGACAATCCCATAGCCCTTTATTCTGCGCATG
ACAGATGAAGTGAAATTCCTTATAAAAAAGACTGGTCAAATTTATTATAGGGAAATTCCC
TAAAATGGGGACAACCCCCTCCCCAGACCAAGAGAGGGGGGGGGACGATATTTTGAAGAG
TAATAATATATTTTCCATACAAGAACTAAATTGAAAATAAAATGAAAAAGGCGTATACAT
TCGAAACCGAAACGATCTTCACTTAGAAATCTTGAGAACATTATATTCATCTAGAATTCT
ATCATATAAAAGTAGAAAGAAGAGCTATCTCCCAACACGGGGAGGTATGCAGCATACTTA
GAAAAAAATGTAATAATACTGAAAACAATATCCAAACTGATAAATAAAACAAGTATTATT
GACACTAAGAATACATAGTAAGAGATCTAAGAAAATAAAACTCCAAACGCGACCATCTAC
TAATAGCAGTAGACACATCAAGACATCAGAACTCACAATCGCCAGAGAACTTAGGAATCA
CCCCCCCAACAAGGATGAGATACATAACAAACGGCCATGGTCAATATCCAATACGACTCT
AACTTCTTCTCCAGACTTAATAATCAAGCTTGGATAGAGACACAAAGGAATGTATTCTAA
TCAAATTATAAGACTCCTATCTACATGCCTTAAAAGTTATCCAAATCAAAAACTTACATT
ATAATTAGTCTATCTGTATCATAAACAAGTCCATAACTAAACTGATGAAAACTGAACACG
ATCAAATGCAACACACTTATCACATATCGACCAATACGTTATAAAATCACAATCGCAATC
ATTCAAAAGACTCACGAACATACTTATGAAAAAATCCACTACCTCACTTGTACAATATAG
ACTATATTTATTATTTACACTGTATCGAACAGATACTAATATATCCCTATATCATTTAAC
GACATTAATTCCATAACGTAATCTATAACAACTCTAACTACATATTTAGACGAACACATA
TGTATCTGACACGACACTAAATAATATTGTAAAGATAATATTCATCATAAAATATAAAAA
TTGCATCAATACTCTTAAATCAAGTCAGCTTTCCATACTATGACTCAACATATCTTCATA
AGTAATCATACTTGATTATCGTATATCCACTCCAAATTACCTTGCTTACTACATGATCTG
CGGGTGCCATGTTATTATTTACTGGAGATTTGCTTAAATGCTCTCTACCTTCACTTATAG
CACTAAAAAGTAGTTCATAAATCAAACTAGTAATAAATCGACTATAAGCCATCTGCATCA
ACTTCCAC
GenBank Accession FR813035 [GenBank]
Graphic View Graphic view of sequence FR813035 of line 600G05
Predicted Position of Insertion Chr3:16457319 - go to primer design
BLAST e Value 6e-04
Hit Clone Code (BAC ID) F14D17
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g43570

 
Sequence (A. th genome BLAST matches underlined)
>39-K023961-022-600-G05-8409
GCACTGCATGACACATAAGCACTTACATTGAATATACTCCGACGGAAGCCTCCCTATAGT
GAGACCGTACGGCTGTACCTTGTTGCGATCCGCGCTACATTGCGTTAAATTGATGGACCC
CCCAAGTGCCGCATCCGGAGAGTACTGCGACACAGAGAAACCAGAGTTCCCATGTGCACA
AGGAAAGGGCTACTATGGCCGTGGTGTTTTCCAACTCGGAGGGGGGGACTGCTACCGACT
CTGTTTCACAGGGCGTGGGCGAGAACTTCTTGACAACGGCTTAGACCGCTGCTCCATACT
CGGCAATTCCGAGACGCAGGGATTCCCGCCACAGGGAGACAGGGGGTCCCCCGAGCCATG
GGAGAACTGGGGAATCCGCCGTAAAGGGAGCCTCGGGAACCCCCGATAAAGGGAGTCTCA
TTTGTCTCGAGGAAAGGGGTGACTGCAACAAGGTAGAACCATATGGACGCAAGAACCAAA
CCTATAGTGGTGGA
GenBank Accession BX892293 [GenBank]
Graphic View Graphic view of gene At2g43570
Predicted Position of Insertion Chr2:18076851 - go to primer design
BLAST e Value 4e-40
Hit Clone Code (BAC ID) T1O24
Hit Gene Code At2g43570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation chitinase, putative
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03