SimpleSearch - Line and FST details


Line specific information

 
Line ID 600H03
Vector Used pAC161
Line Availability only available from NASC (N457591)
Segregation Analysis 50:47:36
Confirmed for Hit At5g46210
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g06040

 
Sequence (A. th genome BLAST matches underlined)
>24-K023925-022-600-H03-8409
CCCGAAGTTCCCGAGGTTTACCGAGAGTTGGTCAAAATCAGCTGCTTCAGGGTCTGACCT
CTATGGGATCCTCCCTATAGTGAGAGCCCCGANTCCTCCTTTGCTTTCGCTTGCTTGTTG
GATTAATTTTGTGGAGGNGCCTATTACTCTTAGGGGGGGGGGGGGGGGGGAAGCATGTGG
GCTCGACGCCTTTTGTACTTTTGTATAGTTTTGCCTCGCGACACTAAGTTAATGAGGTAG
GTGTATTGTGGTCGTCTTAGCTTCACATAGTTTTTGATAGTGAGTATTTGGACGTCCGAT
AATTGAGGTCTTAATTATTGCCACGAACATCGTTTGCTCTTGTGGGTATCTATGTCCTGG
AGACGGTTGGTTTTGGGGGCCCTAATGTTAACACTTCACGGTGCATAGTTGGGTTTTACA
TGTTTCAGTTATTGGCGATAATGATTATGTGGAGCGCAAATAGCGCGCTGCTTCTCTGTC
GCTCTAATCGCAACTCATATTGTGTCTCTTGCAAAAGCTATGGCTGCGACTTGTGTGTGA
TACTACGAGCTGCTTATATCTTTTGAGGCGTCTAACTTTGGACTATAAAACGCATTAAGA
TGACATATCTGATCTTAAGGTTTGAAGATGATTAGCTTAGGATCGCTACTCGCAGAACTC
TGTCCCTTTAGTGTCAGTCTTTGCTCATGACCTGTGCATTTATTACTGATCTAACATCAA
AGGAACTTTGTTCTCAGGATCTCGTTGACCTGATTTGTTTCTTTGAAACTTGCTATACTG
TGTGTCGCCATGTGCTGCCCCGACCTTCGTAATTGTCCGTTGTCTTCATACTGATATCTT
TTGTTATTTATTACTTGTTTGGCTCATCTAGCTTATTGACACAGGTTGTCAACTGTTATC
TATTCGTTCTCCCTTTAAATGCCTAGTCTTGCTTTGTTATTGGAATTGGATTCTTTGATA
AATTGTTCGTAGTCTACCATTTTACTAACATTCATTTGCTGGCTGCCAGAGTCCGTCTGC
CTCTCTATTTCGCTCATGAGTGTATTCATATGCGTGGATTCACCATATCTCTCCTCTTGT
ATGCTAATTCACTGTCCTACGAGCGTGGGCCTTTGTTGTCTATCTTCTTTATCTGTTT
GenBank Accession BX892304 [GenBank]
Graphic View Graphic view of gene At2g06040
Predicted Position of Insertion Chr2:2353334 - go to primer design
BLAST e Value 2e-16
Hit Clone Code (BAC ID) F5K7
Hit Gene Code At2g06040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At5g46210

 
Sequence (A. th genome BLAST matches underlined)
>24-K023961-022-600-H03-8409
CTCTTGATCGTGTCTCTTAGTCCCCAGCGTGTTGTGTTAATGTTGGTTACCCATGCAATG
AAACTCTACCTTTGAAGACATTAAAGATTCCACCAGCATAGAGGACAAGGAGCTGAGGAG
GACTTTGCAGTCGCTTGCCTGTGGGATCCTCCCTATAGTGAGTCGTATTACTCCCGGGNT
TGGGGGGGGGTGGTAACTCAATGNNNTTACCACCNTNNNNAGAANNANNNNNNANNNNAA
NNNNNCCCCNCNNNAAANCGNATTGNNNNNNANNNNNNCACAAANNAAAANNNNAAAAAC
GTGGNGGNNGGTGTNGCGCTTTNAGGCCGGGNNNNGGGNGGNGCGGCACTAGGTGGGGAG
CNAGGAGAGAAGANAGTGCGNNCGAATCTTGTATGCGTAGGACTGGGAGGGGAGCGTAGA
AAGATCGTTGGCTACACAACACGCGGCAGAGAAACAGCAAGCGACAGTACCAGTAGGAGT
CAAAGAGACTGCGACAGTAG
GenBank Accession BX892305 [GenBank]
Graphic View Graphic view of gene At5g46210
Predicted Position of Insertion Chr5:18732630 - go to primer design
BLAST e Value 9e-41
Hit Clone Code (BAC ID) MCL19
Hit Gene Code At5g46210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cullin4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX654249 [GenBank]


Last Updated on 07.07.2016 14:03