SimpleSearch - Line and FST details


Line specific information

 
Line ID 602B10
Vector Used pAC161
Line Availability only available from NASC (N457718)
Segregation Analysis 42:40:34
Confirmed for Hit F11C1 At5g60980
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F11C1

 
Sequence (A. th genome BLAST matches underlined)
>26-K023858-022-602-B04-8409
TTTTTTAGTGTTATTCCGCACATGAACCATTTACATTGAATATATCCTGTCCTTACCTGA
TGTGAGATGCCCACCATGTCCGGCTTTACCTTCTCAAAGCACGGTCTCAAGATTACACAT
GTAGTGTTGTAAGGTTCCTAGGAATTCGCTCTCCAACCGAAATACATCTTTACTAACGTG
AACCTCTGCTAAACTCCTATCCATACCTAAATCCAACCTTTCACATCGAATATAGTATAT
AGTTCATGTATCCACGAAAATTTGGTCAATTCTAATAAATACAATGAGTACCTACAGATC
TGATCCAGCTTCTTTTCTGCTCCATTTTTTTAAGCGATTACCAGATCTTAAGTTTAAATC
CATATTCCCAAAAACCACTGTTCGCTGAAAGATTCCAACAAAAAACTTCCATGCGAACAC
TATCAATAGAGACGACTGACCTCAATAATCAATGTAAACAAAAATAGAAACTAATATAGC
TAGATCCGATATAGCACCCATCATATTTACTCAAAAATACA
GenBank Accession BX892405 [GenBank]
Graphic View Graphic view of sequence BX892405 of line 602B10
Predicted Position of Insertion Chr3:18669152 - go to primer design
BLAST e Value 3e-62
Hit Clone Code (BAC ID) F11C1
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g60980

 
Sequence (A. th genome BLAST matches underlined)
>26-K023857-022-602-B04-8409
ACATGAACCATTTACAATTGAATATATCATTCACTTACATGCTGTGACCGGTCTCCCTTT
GTACGGCTTTGGCGTTCCCAATGTACGGGCTTCCGGTTCCCTCTGAAGGGCTTTAGGTTC
CCAATGAAATTGCTATCCACAGGAAACACACCTTTTCAACCTTTTTCCCCTGCTATGGTA
TCCTCCCTATAGTGAGTCGATCTGTTTCTTTTACTCTTTCTCGATTTGCTTCCAATCTTG
ATCTCTTTTCTCTTTCTATATCGAGCTTGATCTGACTCATTCTTTATTATATACTTCTCT
TCTCGATTCCTTTTTTGTGAAAAAAACATCTTTAAAATTTCATTTTTGTTATATGCTTCA
TGTCTTGATTAAAGTTGATCTTGCAACAGGGATTTTTTTTTTAAATACAAATCAGAAACA
A
GenBank Accession BX892404 [GenBank]
Graphic View Graphic view of gene At5g60980
Predicted Position of Insertion Chr5:24543354 - go to primer design
BLAST e Value 8e-75
Hit Clone Code (BAC ID) MSL3
Hit Gene Code At5g60980 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nuclear transport factor 2 (NTF2) family protein with RNA binding (RRM-RBD-RNP motifs) domain
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23