SimpleSearch - Line and FST details


Line specific information

 
Line ID 604C03
Vector Used pAC161
Line Availability only available from NASC (N457915)
Segregation Analysis 50:46:44
Confirmed for Hit At5g03720 At3g53240
Parent of DUPLO pair none
Parent of pair(s) 94290, 94293, 94296, 94300

Gene hit At5g03720

 
Sequence (A. th genome BLAST matches underlined)
>19-K024459-022-604-C03-8409
GAAGCCATTTACAATTGAATACTATTTGGTTATACCACTATGACATCGCGTTCATACCGC
TGTTACATAATGACGAGCTGTGCCTCTGCTTTGCTGCTGAAGCTCAACCATTTCCTCCAT
CAATGCACGCCGCTCTTTCCTCAGCTTCTCAATCTCTCCTCCAACCTCAGTAGGTGACCC
TTGGCTTTGGCTATGGGATCCTCCCTATAGTGAGACCTATTANTCTCTCCCTTATGNGGT
TTTTGTTNTTCTNTCCNTTTTTTTGTTTTTTTTTTTTCCTTCTCCTCTGCTCGCGTCTCG
CCCCCTGGGTGCTGCTCGCGGGTGTGCGTTCGGGTCCCCGCGCCGGGGCCCCCTTCTCCG
CGGTCGCCTCGCCCCCCTGGCCTGGCCCTCTCTCGTCCCCGTCGGCCGTGGCGCGGTCCC
CGCCCCGCCCCCCGGGGGCCGGGGCGCCGGCGGGGAATCCCTTTTCATCTTCCGATTGGT
CTGAGATTATGCTAAAATTAAACTCATAAACACAGATACTGACAATTTGACCTACCAATT
CACGCGACCCCATGGAG
GenBank Accession BX943451 [GenBank]
Graphic View Graphic view of gene At5g03720
Predicted Position of Insertion Chr5:972522 - go to primer design
BLAST e Value 1e-61
Hit Clone Code (BAC ID) F17C15
Hit Gene Code At5g03720 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heat shock transcription factor A3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g53240

 
Sequence (A. th genome BLAST matches underlined)
>19-K024444-022-604-C03-8409
ATTTACAATTGAACCCGATAATGAATTGCGTGAGAGATTCAGCGAGCGTACTCTCTTAAG
ATCTCCTATGGGATCCTCCCTATAGTGAGACGTATTAATCCCCCCCATAATGGGACTTCG
CTATTTCCTCACCTTCTAAATCTCTCCTCCAAAATCAGTAGGTGACCCTTGGCTTTGACT
ATGGGATCCTCCCTATAGTGAGACATATTACTCCCGCCTCAATGCNGTATTTTTTATTTT
TGGNAAACTGGGATCTCCGGGGTTCAGGATAAGGCGGAAGCGGTGTGCGTNNGAATGACC
CAACCCAGTAAGAGCNNTACGCNCTTGAAGANTTTTCATTTTTCAACTATGGGCAGGTGT
GCTGCGGGGCCGAGCCTTAGCAGACCTAGGGCCTGAACCCATATNCTTTTGATCAACCCT
GTTAGGTGTACACTATAAAGTGACTTTGGATGCTAAGAAATGCCGCAAGCGAGAAGCGAA
TACCTAGAGTAAACGGTGTTACATTTTAAAAAGGTATACATCTATCAATGGAGA
GenBank Accession BX943450 [GenBank]
Graphic View Graphic view of gene At3g53240
Predicted Position of Insertion Chr3:19738593 - go to primer design
BLAST e Value 1e-24
Hit Clone Code (BAC ID) T4D2
Hit Gene Code At3g53240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation receptor like protein 45
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40