SimpleSearch - Line and FST details


Line specific information

 
Line ID 604D02
Vector Used pAC161
Line Availability only available from NASC (N457926)
Segregation Analysis 50:49:38
Confirmed for Hit At2g33710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g33710

 
Sequence (A. th genome BLAST matches underlined)
>12-K024459-022-604-D02-8409
GTTCACTCTTGACATGCAGATGGTGACTTACATGGGACTCGCCTGATGAAGTGATACTTC
CTTAACTATAGGATGGATAGGTGCTTTCGTAAGAGTAATAGAGGGCGTTTGAATCATATG
ATATGATCATTCTACATCAACTTTTATTCCCCTCTTCTACATCTACTTATGAAATCTATA
TATTAGGCCAAACCTACATTTATACATTCCTCTCTCTCGTAATTGGTAATTAACTATATA
TATACTTATGTATCACACCAATGATATAATTAGGATATAAATTAAGTTTGATCATTTTAA
ATACGTTTTCCCCATGTTACAATCCTAAAACTCTCTCTGGCTATGGGATCCTCCCTATAG
TGAGT
GenBank Accession BX943464 [GenBank]
Graphic View Graphic view of gene At2g33710
Predicted Position of Insertion Chr2:14259775 - go to primer design
BLAST e Value 2e-134
Hit Clone Code (BAC ID) T1B8
Hit Gene Code At2g33710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03