SimpleSearch - Line and FST details


Line specific information

 
Line ID 606F07
Vector Used pAC161
Line Availability only available from NASC (N458147)
Segregation Analysis 100:97:90
Confirmed for Hit At5g12860
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g12860

 
Sequence (A. th genome BLAST matches underlined)
>54-K021122-022-606-F07-8409
TTTACAATTGAATATATTTACGAAAAGCCATTTTGGGTTTGGGTTTGGTCTTTTTAAATC
GACGAAACATACAAAGCATAATCCTTCACTCAACAAATTTTCTATTGATTTATTAGCTTT
GTTTTTTGGTTTTGAAAGATCTTAAACTATGCGTTTACTATGGGATCCTCCCTATAGTGA
GTCGCATTACTCAGGGAAGCAGTCCTGATTCCCGACAAGATGTGTTCCCTGAGATGTTGT
TCCCCCGCAACAAAGTCATGAAAATGTTACCACATTTGTGGGAGACCAGGTCACACATAC
ATGCGGCTGTTGTCGCGCTCTGAGAACTTTACGTTTCCGCTCCTGTGCCGAGTTTGATCC
AAACGTGGTACGTATTCACCACAATGGGGGGGCTCTAATGAGGAGAATTTAT
GenBank Accession BX654469 [GenBank]
Graphic View Graphic view of gene At5g12860
Predicted Position of Insertion Chr5:4062162 - go to primer design
BLAST e Value 5e-73
Hit Clone Code (BAC ID) T24H18
Hit Gene Code At5g12860 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation dicarboxylate transporter 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40