SimpleSearch - Line and FST details


Line specific information

 
Line ID 607B12
Vector Used pAC161
Line Availability only available from NASC (N458200)
Segregation Analysis 50:45:44
Confirmed for Hit At1g72040
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g32050

 
Sequence (A. th genome BLAST matches underlined)
>90-K021276-022-607-B12-8409
TGGGATCCTCCCTATAGTGAGACTGGAGTGACTGTGTATGAAGAGGCCTCCACTCAGGTG
CGAGATCCCAAATCCATTGAGAGAACGCCACGCTGGCATAATTACCAAAGACGTCTCTTC
TGAGGGCTGGTCCCAGTATCTCTGTGGATGAATGTCTTACTACCTCAACCGTCGTAGTAA
CAATGGTTATCCCCACTATATTAAGCAAAAGCCGTCCGGTGGACAAACTGAATGAACAAG
ATCCAAGTCATTCATTCTGCCTTCAAATTTTGGGCCAAATACCACTGGGCTTTGTTAATA
AAACAAATGAAATCATTTATCCTTATTCGATATATTAAAGAATTGAACCATATAATAACC
GAGCCGAACCTATCAATGCATCAACCCGTGATAAAATTCAAACGAACACAACAACATCGT
AATACTACATTTCAAGCTATGGTATCCTCCCTATATTGAGC
GenBank Accession BX654566 [GenBank]
Graphic View Graphic view of gene At4g32050
Predicted Position of Insertion Chr4:15496789 - go to primer design
BLAST e Value 3e-53
Hit Clone Code (BAC ID) F10N7
Hit Gene Code At4g32050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation neurochondrin family protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At1g72040

 
Sequence (A. th genome BLAST matches underlined)
>90-K021669-022-607-B12-8409
ACACTTTCAAAACTATAAGATTTTAATATCTGTTGGCCTTTAAAATTACCTATTCGAGTC
ACATGAAGACACTCACTTTCCATCAACCTGACATGTTTATCCCCACATTTTTACTCTTTC
TCCTGCCTCACCCGACTGACAGACACCTAATTCTGGAAAGTATAACCATACCTCTGAGGC
TCCGACTATAAAGCATCCAATATATTGAAATGGTCAGGTCCAACATCTTGCCACTTATCA
ACTGGTTCAGGAACAATCTCAACAATGTCTTGTAACTCGGCGGTCTCATTCACTATCCAC
AGAATACCAGTTAATTTACTCACCCTGAGGTTCCCTTCCCCCTAAAACGTCGAACGTTTC
TTCCCATTATGATTAGGTTCA
GenBank Accession BX654567 [GenBank]
Graphic View Graphic view of gene At1g72040
Predicted Position of Insertion Chr1:27112854 - go to primer design
BLAST e Value 1e-73
Hit Clone Code (BAC ID) F28P5
Hit Gene Code At1g72040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40