SimpleSearch - Line and FST details


Line specific information

 
Line ID 614A02
Vector Used pAC161
Line Availability only available from NASC (N458850)
Segregation Analysis 50:37:21
Confirmed for Hit At4g35040
Parent of DUPLO pair 12243
Parent of pair(s) none

Gene hit At4g35040

 
Sequence (A. th genome BLAST matches underlined)
>09-K021890-022-614-A02-8409
GAGTTTAGACTCTACCAAAGTCATACAAAAGTTAGCTGTGCCTTGTCCTTCCAATAGAGG
AAAGATTGGCTACTTACCGCGCTTAAAATACAGAGCCAATATTCTTCCCCCTGTAACCCA
AATAGAATCGCCCTTTCCTTTCCCTTGGGACATGCCCTAAGACCCCTGCACGCACACTCC
AGCGTCGAATACTCAGCTACCCCCGTATTCTGAGGGAGCCTCCCCATCGCGAGCTGCTGA
TTCACCGCCCTAAGCCTTGCAACCTCATCCTCCAAAGAAGCAGCTTTAGCCTTCTTCTTC
TCTCTATACTTTCTAACCGCTTCCCGGTTTCCCAAAGGTCTCTTTTCACCCTTCTTCCCA
CAAGACTCAGCTGTATCATCAGTAGAAACTTTTTCAT
GenBank Accession BX656358 [GenBank]
Graphic View Graphic view of gene At4g35040
Predicted Position of Insertion Chr4:16681554 - go to primer design
BLAST e Value 4e-89
Hit Clone Code (BAC ID) M4E13
Hit Gene Code At4g35040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Basic-leucine zipper (bZIP) transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX656358 [GenBank]


Last Updated on 31.08.2016 09:40