SimpleSearch - Line and FST details


Line specific information

 
Line ID 615B12
Vector Used pAC161
Line Availability only available from NASC (N458968)
Segregation Analysis 50:28:24
Confirmed for Hit At3g13150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g13150

 
Sequence (A. th genome BLAST matches underlined)
>90-K021911-022-615-B12-8409
TGGAGGCGACTGTACAGCGACGAGCCTACCTTGCTCATAGCTTCGTGCAGGTGGTGAAAA
TGTCAGAGTTGAGTGTGAGGGTTTAGGGTTTTGGACTTAAGAGTGCTCCTCCGGCTATGG
GATCCTCCCTATAGTGAGACNTATTACTCCCCCCCCTCTCCCGATCTCTCCCGTCACTGT
CTTCCTTTTTTTTGTCTCTTTCTTNAAATCCTGCCGTTCTCTAACCAAAAAAGGAAATAA
TAAAATTTCTTTTATCTTTAACAATTAACATCAACACAAACACACTACATATAAACATAT
TTCAATTATTAAATCACCTCACTCCCAATTTGCAACAATACATTAAAAAAATGGAAACAC
AAACTAAATTAAAAACTAGTCAATAAGCCTTGCCAATTAACTACTCTTTGGGAAAGAGAC
GAAGCTTGCACTGCAAATANTCATTCGTCTTTGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX656478 [GenBank]
Graphic View Graphic view of gene At3g13150
Predicted Position of Insertion Chr3:4229615 - go to primer design
BLAST e Value 6e-79
Hit Clone Code (BAC ID) MJG19
Hit Gene Code At3g13150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX656479 [GenBank]


Last Updated on 07.07.2016 14:03