SimpleSearch - Line and FST details


Line specific information

 
Line ID 622A04
Vector Used pAC161
Line Availability only available from NASC (N459620)
Segregation Analysis 50:45:40
Confirmed for Hit At4g15280
Parent of DUPLO pair none
Parent of pair(s) 1194, 4900, 4905, 8534, 8549

Gene hit At4g15280

 
Sequence (A. th genome BLAST matches underlined)
>25-K021999-022-622-A04-8409
TGGGATCCTCCCTATAGTGAGACTGTATTACTCCCGGGATTATCCATATATGGAAACACA
ATGGACTTCCATGTAATATGAAATACACGTAATAACGCTACGTTTTTATGAACCATGCTT
CACGTTCAACAAATGTACTATCAAAAGAAGTATGACGTCAGCGAGTTAGAAAAGTCGGTC
ACCGAGTTGGAGTTTCCCTCTCTGACTCGTCCTTATCCAATGAAATGTCTTCCTCATAAC
CTCACTTCAAAGGAGAGAATACCTCTCTCACTAAGGAATACACCCAAAAATGAGACAGAG
AGCAAATAAAAATTAAAAAACAAAAAAAGAAAAGACCCAAAAAAGAAGCAAAAAAAGAGA
GGGGGGAAAAAAAGAGAAATTACGGGGAGGGGGAGAAAATAATAACTATATCTTATAC
GenBank Accession BX657030 [GenBank]
Graphic View Graphic view of gene At4g15280
Predicted Position of Insertion Chr4:8719514 - go to primer design
BLAST e Value 3e-71
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g15280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucosyl transferase 71B5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX657030 [GenBank]


Last Updated on 31.08.2016 09:40