SimpleSearch - Line and FST details


Line specific information

 
Line ID 624A04
Vector Used pAC161
Line Availability only available from NASC (N459812)
Segregation Analysis 50:49:33
Confirmed for Hit FCAALL
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit FCAALL

 
Sequence (A. th genome BLAST matches underlined)
>25-K022001-022-624-A04-8409
CATTTACATTGAATATAATGGAGAATTTGTTGAGATGGTGTGAACACGAAGTAGTAACAA
CTAACAAGGTAATTAAGGATCATTGGCTTATATAATAAATAGATTTAGAAAAAGTAATCA
GTCAATGTTGATCATCATCTTGACAAATTCATCATAATTGACTTGGCCATCACCATCCAA
ATCTGCCTCCTTTATCATTTGTTCAACTTCTTCATCTGTTAGCTTTTCTCCTATGGGATC
CTCCCTATAGTGAGACTAAGGAATCCTCCCTATAGTAACGCTGCGGACATCTACATTTTT
GAATTGAAAAAAAATTGAAAATTA
GenBank Accession BX657417 [GenBank]
Graphic View Graphic view of sequence BX657417 of line 624A04
Predicted Position of Insertion Chr4:8400099 - go to primer design
BLAST e Value 1e-120
Hit Clone Code (BAC ID) FCAALL
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX657419 [GenBank]


Last Updated on 07.07.2016 14:03