SimpleSearch - Line and FST details


Line specific information

 
Line ID 624A04
Vector Used pAC161
Line Availability only available from NASC (N459812)
Segregation Analysis 50:49:33
Confirmed for Hit At4g14640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g14640

 
Sequence (A. th genome BLAST matches underlined)
>25-K022001-022-624-A04-8409
CATTTACATTGAATATAATGGAGAATTTGTTGAGATGGTGTGAACACGAAGTAGTAACAA
CTAACAAGGTAATTAAGGATCATTGGCTTATATAATAAATAGATTTAGAAAAAGTAATCA
GTCAATGTTGATCATCATCTTGACAAATTCATCATAATTGACTTGGCCATCACCATCCAA
ATCTGCCTCCTTTATCATTTGTTCAACTTCTTCATCTGTTAGCTTTTCTCCTATGGGATC
CTCCCTATAGTGAGACTAAGGAATCCTCCCTATAGTAACGCTGCGGACATCTACATTTTT
GAATTGAAAAAAAATTGAAAATTA
GenBank Accession BX657417 [GenBank]
Graphic View Graphic view of gene At4g14640
Predicted Position of Insertion Chr4:8400099 - go to primer design
BLAST e Value 1e-120
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation calmodulin 8
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit BX657419 [GenBank]


Last Updated on 07.07.2016 14:03