SimpleSearch - Line and FST details


Line specific information

 
Line ID 625A10
Vector Used pAC161
Line Availability only available from NASC (N459914)
Segregation Analysis 50:44:42
Confirmed for Hit At2g01930
Parent of DUPLO pair none
Parent of pair(s) 649, 2835

Gene hit At2g01930

 
Sequence (A. th genome BLAST matches underlined)
>73-K022320-022-625-A10-8409
GAGAATCCGATTCCTCCTCCTGCTCCTTGTAAAGAGCAGACTGGTAACAGTCACTAGACG
AGATGTGGCAACCTGGCTCCAACGGCACCAAAATCCAAGAAGATGCGCATGCCGAAGGAA
GAGAGAGATGTTACTAACAACGATGTTCAGCAACAGCAGCAGCGTGTGAAACCGGTTACC
AAGACTGTTGA
GenBank Accession BX657579 [GenBank]
Graphic View Graphic view of gene At2g01930
Predicted Position of Insertion Chr2:427972 - go to primer design
BLAST e Value 5e-30
Hit Clone Code (BAC ID) F23I14
Hit Gene Code At2g01930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic pentacysteine1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40