SimpleSearch - Line and FST details


Line specific information

 
Line ID 625G03
Vector Used pAC161
Line Availability only available from NASC (N459979)
Segregation Analysis 50:47:35
Confirmed for Hit At3g09620
Parent of DUPLO pair none
Parent of pair(s) 12006

Gene hit At3g09620

 
Sequence (A. th genome BLAST matches underlined)
>23-K022320-022-625-G03-8409
NNNNAAGCAGAATCCGGACATGAGCCATTTACATTGAATATATCCTGCCGCCGACAGAGG
TCAAAACCCATATCAAACATACGATCAGCTTCATCCATTACCAAATATGTGACCCTTCGT
AGATTGGTAATTTTTCCACTGCTTGTGCAAAGAATATCGATCATTCTTCCAGGAGTACAA
ACAACAATCTCGGTACCTCGCTTAAGCTCACTGATTTGCTGGGCAACTCCAGATCCTCCA
TACACAGGCACACATATTATACCCAATGCCTTAGAAAACTTTCTGATATCGCTGTAAATC
TGCTGAACAAGTTCTCTATGGGATCCTCCCTATAGTGAGACNTATTACTCACCCCTCTAT
ACTTACTTTTTAATACCCTTTTTTACATAAACTATAACAAACTATAAAATACAACCTATA
TATAAATATAA
GenBank Accession BX657677 [GenBank]
Graphic View Graphic view of gene At3g09620
Predicted Position of Insertion Chr3:2950513 - go to primer design
BLAST e Value 5e-144
Hit Clone Code (BAC ID) F11F8
Hit Gene Code At3g09620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX657676 [GenBank]


Last Updated on 07.07.2016 14:03