SimpleSearch - Line and FST details


Line specific information

 
Line ID 626D12
Vector Used pAC161
Line Availability only available from NASC (N460048)
Segregation Analysis 50:46:34
Confirmed for Hit At3g19170
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g11510 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g11510

 
Sequence (A. th genome BLAST matches underlined)
>92-K022016-022-626-D12-8409
AAAAACTATAGTTCAGTCAAGAAGAAACTTGATTCCTACATGTCAGTCTGGCCTTTTGGA
TCAGTACCAAGCCATGCCCCTATGGGATCCTCCCTATAGTGAGTCCTATTACTCACCCGT
TTGGACGTGAATGTAGACACGCGTGATGCCCAACCTATGGGATCCTCCCTATAGTGAGAC
TATGGAATCCTCCCTATAGTGGGCTACATTGAAATGCTAATTATTATTCGTACAAGCATG
AAAACTCACCATTTGATCTCCCCTATAATAAGACTTAAAACGCCTGCAGGCAAAAACCGA
AGTAAAATAATCAGCTAAACCCATATACTATGGGATCCTCCCTATAATGA
GenBank Accession BX657788 [GenBank]
Graphic View Graphic view of gene At5g11510
Predicted Position of Insertion Chr5:3681762 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) F15N18
Hit Gene Code At5g11510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 3r-4
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 561F08

Gene hit At3g19170

 
Sequence (A. th genome BLAST matches underlined)
>92-K022321-022-626-D12-8409
CTATGGAATCCACCCATATAGTGAGTTCTTACACACAAATTAAACCTGGGATCCTCCCTA
TGGGGACCCCCATAACTCGAGGGTTAGTACGTAACTGTTTACACTTTGTGGTATCCTCCC
TGTGGTGAGCCCTTGGGTTTGAGCGAAGGGGAGTTCACGAAAATTTAGAACTCTTGTGAC
TGTAGGTTTGTGGGTTGGCCCAGAACAGGGGAAATCAGGATGAGAGTAAGTTACCGAGAG
CGGCTAGACACAGAGCAAACTGGAGCGAAGCAGAAGAGACAAGGAAGGGCGAAAGGGCAG
ACAGAAGGGGAAAAACGGGAGAAGGGAGGTAACGGGCACACAGCGGAGAAACACATAGCG
AAAATAACAAAAAATCCAAGAATGAAAAGAGTACA
GenBank Accession BX657790 [GenBank]
Graphic View Graphic view of gene At3g19170
Predicted Position of Insertion Chr3:6632351 - go to primer design
BLAST e Value 0.003
Hit Clone Code (BAC ID) MVI11
Hit Gene Code At3g19170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation presequence protease 1
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit BX657790 [GenBank]


Last Updated on 31.08.2016 09:40