SimpleSearch - Line and FST details


Line specific information

 
Line ID 628D03
Vector Used pAC161
Line Availability only available from NASC (N460231)
Segregation Analysis 50:45:34
Confirmed for Hit At5g07100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g07100

 
Sequence (A. th genome BLAST matches underlined)
>20-K022014-022-628-D03-8409
ATCCGGAATGAACCATTTCCCTTCTTCTTCTCTCATATCATCTTCTTCTTTGATCTTGAA
ATCACAGATTTTGCCGTCTCCTACGACAGGCACATTTCCAGCGCAATCTCTGAACTATAA
CAATAACGGTTTGCTCATTGACAAAAATGAAATCAAATATGAAGACACAACTCCTCCCTT
GTTCCTACCATCTGTAGGATCCATTTTTGCATTTTTAGCTTCTGCTTTATTATCTCTTAA
GACATCCTATGGGATCCTCCCTATAGTGAGACGTATTACTCACCCCTTTGGACGAGAATG
CATACACACTATGGGATCCTCCCTATAGTGAGAGAAGCTTCTAAACCCTAACCCGCTGTA
ATCCACCATAAACTTGGGACCAAGTGTGAGACGGGTGAATTCCAATCGGCAAAATGTTTG
ATTTTTGTGTGTAAAGAAGATGAATTCACATCACTTTAAGGAATCATTGAGGTC
GenBank Accession BX657959 [GenBank]
Graphic View Graphic view of gene At5g07100
Predicted Position of Insertion Chr5:2204553 - go to primer design
BLAST e Value 4e-129
Hit Clone Code (BAC ID) MOJ9
Hit Gene Code At5g07100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 26
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40