SimpleSearch - Line and FST details


Line specific information

 
Line ID 630A11
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g40770

 
Sequence (A. th genome BLAST matches underlined)
>81-K022799-022-630-A11-8409
NNGGCTGTAATCCCGGAATGAAGCCATTTACATTGAATATGTCGCGATTCAGCTTGTCAT
CCATGTGACTACTGCTTATAGAATCGGAATATGACACATCGATCTATGCTTTGGGCCGGG
ACGAGTTATATGTTTCTCTCTGCTTCTCCCTT
GenBank Accession BX892697 [GenBank]
Graphic View Graphic view of gene At2g40770
Predicted Position of Insertion Chr2:17015495 - go to primer design
BLAST e Value 5e-21
Hit Clone Code (BAC ID) T7D17
Hit Gene Code At2g40770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING-finger, DEAD-like helicase, PHD and SNF2 domain-containing protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 10.06.2021 13:37