SimpleSearch - Line and FST details


Line specific information

 
Line ID 631A04
Vector Used pAC161
Line Availability only available from NASC (N460484)
Segregation Analysis 50:42:42
Confirmed for Hit At4g29210
Parent of DUPLO pair none
Parent of pair(s) 68592, 97155

Gene hit F11F19

 
Sequence (A. th genome BLAST matches underlined)
>25-K022084-022-631-A04-8409
CCCATCGATTTCACTCTATGGGATCCCCCCTATAGTGAGATCCTGACCTGAGTGTGGATC
CCTCCTTTATCATTTCCATACTGAGTGTATAGCTTGTATTACTTATTTGATTTCTCTAGG
CTCCTATGGGATCCTCCCTATAGTGAGACCCTATGGGATCCTCCCTATAGTGAGACCTTC
TGCCCCTCTCTTACCTGTCAACAATGTACAATTCGTTAACTTACTCCGTCATTCATCACT
TTTCTACATATCTTACAAAACAGCATCTAATGACTACAAATTTATGTATTTCAACAGACA
CATATGTCCACATCTTATATTAGAAAAGTCTGAACTGAAGTATTATGAACACCTATAAAC
AAATAAAATTTACAAACCCCTGACTAACCCGCAATTACACCACCAATTAAAACAATAATC
AAAAGAAGCATTCGTATGAAAACAAACTATATAAAAG
GenBank Accession BX658031 [GenBank]
Graphic View Graphic view of sequence BX658031 of line 631A04
Predicted Position of Insertion Chr2:15062206 - go to primer design
BLAST e Value 6e-14
Hit Clone Code (BAC ID) F11F19
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g29210

 
Sequence (A. th genome BLAST matches underlined)
>25-K022796-022-631-A04-8409
GACGGAAGACGGCCATACCGCTTTCCAAGCCTCGCAAAGACCAGCTATCTCTCCCGGAAC
TCCCATAGACAATGCGCCCAACGATTTCGCACTATGGGATCCTCCCTATAGTGAGACCCC
CGNCCCCCCCC
GenBank Accession BX658032 [GenBank]
Graphic View Graphic view of gene At4g29210
Predicted Position of Insertion Chr4:14401793 - go to primer design
BLAST e Value 6e-36
Hit Clone Code (BAC ID) F17A13
Hit Gene Code At4g29210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation gamma-glutamyl transpeptidase 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40