SimpleSearch - Line and FST details


Line specific information

 
Line ID 634B01
Vector Used pAC161
Line Availability only available from NASC (N460781)
Segregation Analysis 50:47:37
Confirmed for Hit At5g11510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g11510

 
Sequence (A. th genome BLAST matches underlined)
>02-K022834-022-634-B01-8409
NNNNGGCGTAATTCCGGACATGAACCATTTACAATTGTCAAGATGACATTCTTTCCTTTC
TATATTCATTTACTGAAGTGACCTGTAATCTTCCTTGTCTAAATGCATGTCACATCTTTT
CTTAACTCTCAGCTGAATACTTCAAGGATCGAACTGATGTCCAGTGCCTCCACAGGTGGC
AAAAGGTCCTTAATCCTGAACTTGTTAAAGGGTCCTGGACCAAGGAAGTTACATCCTTTT
TTACTCCCTCACTATTTTTTTTTTTCAATACTTATTACTAATATCCTATCTTATTTCATC
TTCATCTATCTTATTCAATTCTTTCTCCACTTTCTTCTTTCAACACTTTATC
GenBank Accession BX658285 [GenBank]
Graphic View Graphic view of gene At5g11510
Predicted Position of Insertion Chr5:3680985 - go to primer design
BLAST e Value 1e-92
Hit Clone Code (BAC ID) F15N18
Hit Gene Code At5g11510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 3r-4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX658284 [GenBank]

Gene hit At4g08033

 
Sequence (A. th genome BLAST matches underlined)
>02-K022366-022-634-B01-8409
ATGATGCGGTTTTGTTGGACTTTCCGTGTCTATTATTCCCTTTAACATTTGCACTACTAG
AGATCTAACATTAATAAGAGCTATGGGATCCTCCCTATATTGAGATGTATGTGAATCCTC
CCTATGTGTGAGGATATGGGATCCTCCCTATAGTGTGATTGTGTGTTCGCCTCTACTCCT
ATTGCGTGTTCACTGTCTTCGGCCTGTTTTGTTGACACTGGATGCTCCCCTTTCTTTGTT
CTCAATTCTCCTCCAGGGTGGGCATTTCATTTATTAGAGCGGTTTTTCGTTTGTTTCTTT
ATTTTTTTGTCTCTACGTGTTTGCATGTATCGATTGTCTAGAATTCAGTATTATGTATAT
AGGGAATGTGATGTACGTTGTTGCATATGTTGTTCTAGGTACACTAGTTAAACTATTGAA
ATTTGTGTGGAGATTAAACTAGTCGTCAAGTATAATCGATCTTATTTACGGTAATCATCA
ATGTATTTTTAATTTGATT
GenBank Accession BX658283 [GenBank]
Graphic View Graphic view of gene At4g08033
Predicted Position of Insertion Chr4:4876840 - go to primer design
BLAST e Value 6e-11
Hit Clone Code (BAC ID) F1K3
Hit Gene Code At4g08033 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 31.08.2016 09:40