SimpleSearch - Line and FST details


Line specific information

 
Line ID 635C09
Vector Used pAC161
Line Availability only available from NASC (N460897)
Segregation Analysis 50:35:29
Confirmed for Hit At2g01580 At1g72370
Parent of DUPLO pair 3208
Parent of pair(s) none

Gene hit At2g01580

 
Sequence (A. th genome BLAST matches underlined)
>67-K023806-022-635-C09-8409
ACACTTCGTCCGTTTCTTTGCTGATCAAAGGGTTGATGGCTATGAGATCCTCCCTATTTC
GTAACGGTCTAACCTATTACTCGATGACAAGGTCGCTTATAACTCCTGCTATGGGATCCT
CCCTATAGTGAGTTTAATCCCAACCAGCAGCTGGTGCCCCTGAGGGTGGCGCGGCAGCTT
CCCATCCACCATCTGCCGGTGCAGCTATGGGATCCTCCCTATAGTGAGTCGGAATACNCG
AGGCCCTACAAAAAAGGGGTTTTAAGATAAACTTCTGCATATATGGACAAGAATATCCCC
TTCACAAAGATACTCTTTTCATCTTCAGATTGAGTGAGATTTAAGCCAAAATATAGACTC
GTATACGTAAATACTGACGAGATGACCCATTCGTCCCGGGAGAGCCCTTAGATTATCCCA
CCCCATCCACCCCTATACGTCAATACTGAAAGATTTGAGCACCCATTCTATGTACCC
GenBank Accession BX892972 [GenBank]
Graphic View Graphic view of gene At2g01580
Predicted Position of Insertion Chr2:265417 - go to primer design
BLAST e Value 2e-10
Hit Clone Code (BAC ID) F2I9
Hit Gene Code At2g01580 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g72370

 
Sequence (A. th genome BLAST matches underlined)
>67-K023732-022-635-C09-8409
TATTACTCGATGACAAGGTCTCTTATAACTCCTGCTATGGTATCCTCCCTATAGTGAGTC
TTCTTACTCCCGGCTCCTGGCGTTTTTGAAGATAACCGGTCAGGATCCTATACCCATGCT
CGTTGCCTCCATCAAAGAGACTACTCACAGACGTTGAGGAATCACAGTTTCCCTCCGTAA
AAGGCATCTGCGAGAAATATTCGGTCTGGTTCTCAAAAGCAACAAGCTCTTCAGAAAGCT
GATAATCATCAACGTTATTGGCTTCTTACCTATCATAAAGGAGCACTGTTCCCTATCGGC
ATTAAGGATGAATACTTCTTCCAATTATGTACATAGAACCATAATATTAATCATTCTCTA
GenBank Accession BX892971 [GenBank]
Graphic View Graphic view of gene At1g72370
Predicted Position of Insertion Chr1:27242948 - go to primer design
BLAST e Value 2e-63
Hit Clone Code (BAC ID) T10D10
Hit Gene Code At1g72370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation 40s ribosomal protein SA
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23