SimpleSearch - Line and FST details


Line specific information

 
Line ID 635D09
Vector Used pAC161
Line Availability only available from NASC (N460909)
Segregation Analysis 50:40:34
Confirmed for Hit At2g35070
Parent of DUPLO pair none
Parent of pair(s) 12886

Gene hit At5g00490

 
Sequence (A. th genome BLAST matches underlined)
>68-K023197-022-635-D09-8409
AGTAACTTAATCCTATATCTGAGGAGGACAACATGGGGCACTCCCTATGGGATCCTCCCT
ATAGTGAG
GenBank Accession FR813741 [GenBank]
Graphic View Graphic view of gene At5g00490
Predicted Position of Insertion Chr5:9938453 - go to primer design
BLAST e Value 0.001
Hit Clone Code (BAC ID) F14I23
Hit Gene Code At5g00490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation novel transcribed region
Insertion Classification TS2TE
Confirmation Status unknown

Gene hit At2g35070

 
Sequence (A. th genome BLAST matches underlined)
>68-K023732-022-635-D09-8409
AGCCATTTACATTGCATAAGAGTTTCGAATAATGCGAGCCGATATTGAGAAGATGCGAGC
GGATATTGCTACAATACAAGCAGAGGAGAGGTATTAAATTTGACTCGCTTTTTAATATTT
GTTTTTGTCCCATTTAAACTTAGACCTTTCCTTTGAAACAGGTGTGATCACGATAACCAC
ATACACAAAGTTGAGCAGGTATAGCTTTTTTTTTCCTATGGGATCCTCCCTATAGTGAGA
CGAATTACTCACGGGTTTAGACGGAATTGGGAACACAATGGGTTGGACTCCATGGGGAGA
GCAAGGAAACATCGACTCCACGTTAAAGAAAAACTTATTAAATAGCCCCCCCATTAGAGA
ATGAAGCTCAGAACCATCAGTTTCTAAAACGAAACTATTGAACTTAAGAGATTAAAT
GenBank Accession BX892989 [GenBank]
Graphic View Graphic view of gene At2g35070
Predicted Position of Insertion Chr2:14784088 - go to primer design
BLAST e Value 1e-98
Hit Clone Code (BAC ID) T4C15
Hit Gene Code At2g35070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transmembrane protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40