SimpleSearch - Line and FST details


Line specific information

 
Line ID 637C09
Vector Used pAC161
Line Availability only available from NASC (N461089)
Segregation Analysis 50:10:9
Confirmed for Hit At2g32920
Parent of DUPLO pair 49
Parent of pair(s) none

Gene hit At2g32920

 
Sequence (A. th genome BLAST matches underlined)
>67-K022272-022-637-C09-8409
CCATTTACAATTGAATATATCCATCTTTACCATCCCACTCCTTTGTCTTCACGATCTCTG
GTGTTCCATTCATTGGCACATTTCCTTTTCCACCGGTTCCAGCATCTTTCACAAATTCTC
TGATGAAATAACACGAACAATGATTACCGTGTTATAAGAGCGAAAATCACCTAAACCATT
GTGATCCCTATGGGATCCTCCCTATAGTGAGACNTATTACTCATGCCATCCTCCCTAAAT
TGTGATACACTGAATTGTTATCCCTATTAAATACTATAAATAATAAGACTATTCCATCCT
ATCTAAAATTAAAATAATCTATCTCCTCCATTTTAAATATAAAAAAAAAAATA
GenBank Accession BX658529 [GenBank]
Graphic View Graphic view of gene At2g32920
Predicted Position of Insertion Chr2:13962583 - go to primer design
BLAST e Value 4e-92
Hit Clone Code (BAC ID) T21L14
Hit Gene Code At2g32920 [TAIR] [MIPS] [SIGnAL]
Gene Annotation PDI-like 2-3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23