SimpleSearch - Line and FST details


Line specific information

 
Line ID 639C04
Vector Used pAC161
Line Availability only available from NASC (N461276)
Segregation Analysis 50:27:25
Confirmed for Hit At1g73870
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g73870

 
Sequence (A. th genome BLAST matches underlined)
>27-K022256-022-639-C04-8409
ATTTACATTGAATGTGAAGAGCAGTGTACTTCCTGGCTGTGGGATCCTCCTTATTGTGAG
TATTTCGTCTCTTTAATCAGTATGTATCAGCTCAAAGTCAACGGAACTCGACACTACTAA
AGACTAACATAGAGATGAGAGATATAGCTATGGGATCCTCCCTATAGTGAGTCTTATTAG
TCACGCGATTCTCCGTATATTGAGACACTCTGGATTTCCTGCTTTTTGTGGTCCCATGGA
TACCGGCCTGTAGGGACTCCGTGGAGCTCTGCGTAGTAGAAATCACCAATCCGTAGGAAT
GCACCATCCGGTGCACAGCGTCTTAATATGCTGAGGCAAGGGGGAGTAGAAGGCAGTGAA
GCGAAAGGGACGCGAAGTTGACGCGGAACGACGGAGTACAAAAAGAACGTAGAGATTGGA
GTGGAGCCGAATAGCACGTTCGAAAATGATCATTGGGAAACAATAATACAAACTGAAAGG
ATAGGCAAGTGGGATTGGGAATGGAAGACCTG
GenBank Accession BX658743 [GenBank]
Graphic View Graphic view of gene At1g73870
Predicted Position of Insertion Chr1:27780263 - go to primer design
BLAST e Value 2e-32
Hit Clone Code (BAC ID) F2P9
Hit Gene Code At1g73870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation B-box type zinc finger protein with CCT domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g33055

 
Sequence (A. th genome BLAST matches underlined)
>27-K022274-022-639-C04-8409
TCTGTATTTCGCGAATGAAGCCATTTACAATTGAAAAGTCTGTACTTCTACTCCATTAAT
CTTGATAGGCATATCTTCTAGTAGGCCATAGGGTTTTCTTAAGGTCCTATCAGCAAGGAT
CAAAGATAGGTCGCACGACTTATATTTGACAAATCCCAGCTTCTTTGCCATAGAAAGTGG
CATTAGGCTGACTGAAGCTCCTATGGGATCCTCCCTATAGTGAGACGTATTACTCN
GenBank Accession BX658744 [GenBank]
Graphic View Graphic view of gene At3g33055
Predicted Position of Insertion Chr3:13583326 - go to primer design
BLAST e Value 4e-91
Hit Clone Code (BAC ID) T15D2
Hit Gene Code At3g33055 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 07.07.2016 14:03