SimpleSearch - Line and FST details


Line specific information

 
Line ID 639G03
Vector Used pAC161
Line Availability only available from NASC (N461323)
Segregation Analysis 50:22:16
Confirmed for Hit At5g65060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g65060

 
Sequence (A. th genome BLAST matches underlined)
>23-K022256-022-639-G03-8409
CACTTGTTATTATTTTTCTCTCTATCGTCTAACAAAAAAAAAAACGGATTGGGAATTTTT
TTCCTTTGGCCAAGGGAACCCCCCCAAAAGGGGGCCAAAGGACCCCCCCCTTAAAGGGGA
ATGGGAAAACCCCCATTTAAAAACCCAAAGAAAACCCCCATGTAACCCCCCAAAAGGGGC
CCCCGAGAAACCCCCCATTTGGGGATCTTAGAAATCCACACCTATACAGGCCAAGGAAGC
GCCAAATGAGACCCGCACCGGAGAAAGCCCAAAGAAACACAGTAACAGGAAAGCAAAGAA
GAACCTACAAAAAAAAACAAACCAAAAGGAAAAGATCAAGCAGAGAAAGAACGCTAACCG
AAATAACTAACACAAAATAAAAAAAGAGAATCAGTGGAAAACAAAACGAACGGATCCGGG
CGGAAAACCGGAAAGAGAGAAACAGAATAGAGAAAAAATGAATCCAGAAATGAAAGGTCA
CAGAGCAATCGAGAAGAAGACGCAAAACAGAGGACAAATGAA
GenBank Accession BX658792 [GenBank]
Graphic View Graphic view of gene At5g65060
Predicted Position of Insertion Chr5:25987351 - go to primer design
BLAST e Value 9e-10
Hit Clone Code (BAC ID) MXK3
Hit Gene Code At5g65060 [TAIR] [MIPS] [SIGnAL]
Gene Annotation K-box region and MADS-box transcription factor family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23