SimpleSearch - Line and FST details


Line specific information

 
Line ID 640E09
Vector Used pAC161
Line Availability only available from NASC (N461401)
Segregation Analysis 50:48:34
Confirmed for Hit At1g03040
Parent of DUPLO pair 2301
Parent of pair(s) none

Gene hit At1g03040

 
Sequence (A. th genome BLAST matches underlined)
>69-K022275-022-640-E09-8409
TTACTGTTGTACTCTGACTTTACTTGATCCTCCCTGAGCCCTTTTTCCCCGATTTTCTCA
TATTACTGTCTCTCGCTCCTTATTAGCTTATTAGAGTTGTTTAATCTGGCAATAAAGAGT
ATTCCAAGAGTACATGATTGTGTGTTTTTTGGCATTACTGTCTTTCACTTTTTCCTTGCT
TCCCTCCCATGGAGAATCGTCACCTTTGAAGACTATTGTAATAAAGCTAATGAAAACATT
GAAGAATATTTTATGCAATGATGGGCTTTGATAATATTTTTCCTTCATAAGCTTTATCTC
TGGACATCTATGGCAGGTCCTAGAACATAAACCGTCTAGGTGAAACAAGATCATACAA
GenBank Accession BX658880 [GenBank]
Graphic View Graphic view of gene At1g03040
Predicted Position of Insertion Chr1:704959 - go to primer design
BLAST e Value 3e-98
Hit Clone Code (BAC ID) F10O3
Hit Gene Code At1g03040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g04850

 
Sequence (A. th genome BLAST matches underlined)
>69-K022255-022-640-E09-8409
AGCGTTCCCCACTCTGGTGACTTACATGGCGATATGTCGCTAAGAATCGAGATGAGGAAA
AATTCCGGAAAATTAGACTCACCAACCTGACATTTCAGGTAAACAATCGGGCATAAAAAT
ACGCATCTATGGGATCCTCCCTATAGTGAGACCAATGGATCCCTATCTGTCTGCAGAAGG
AAGGCAAACGAAACAGATGTGAATACCGCAGTTTCTATATGCCAATCACAAATCTTTTCT
CTCATTGACAAATCTATGGAATCCTCCCTATAGTGAGATGAAAAGATAAAGACTAGAGAA
TACAATATTATGACATAAGGAAAATAAGAAACAAGAACA
GenBank Accession BX658879 [GenBank]
Graphic View Graphic view of gene At1g04850
Predicted Position of Insertion Chr1:1365710 - go to primer design
BLAST e Value 1e-45
Hit Clone Code (BAC ID) F13M7
Hit Gene Code At1g04850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ubiquitin-associated (UBA)/TS-N domain-containing protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 31.08.2016 09:40