SimpleSearch - Line and FST details


Line specific information

 
Line ID 641D12
Vector Used pAC161
Line Availability only available from NASC (N461488)
Segregation Analysis 50:49:29
Confirmed for Hit At2g40620
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g53905

 
Sequence (A. th genome BLAST matches underlined)
>92-K022816-022-641-D12-8409
GCCATTGGTCACGACCTTACTTGAACAGGATCTGTTCTATAGGCTCGTACCTCTGTTTCC
TTGATTTCTCAAGAGACAGGCCCTTAACCCTGGTTGACCAAACATGACCCTCGCAATGAC
CGCCTTTAGCCACAGCTCCAACACCTGCGCCAGACCGTGGTCCATACCACCCCACACTCA
TTCTGA
GenBank Accession BX658964 [GenBank]
Graphic View Graphic view of gene At5g53905
Predicted Position of Insertion Chr5:21888283 - go to primer design
BLAST e Value 3e-47
Hit Clone Code (BAC ID) K19P17
Hit Gene Code At5g53905 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation prolamin-like protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At2g40620

 
Sequence (A. th genome BLAST matches underlined)
>92-K023145-022-641-D12-8409
ATCTGTTCTATAAGCTCGTACCACTGATGACCTTGATTACTATGGAGACAGGCCCTTACC
CCTGGCTGACGAAACCAATCTCTCGCAATGCCCGCCTTTAGCCACAGCTCCGACACCTGC
GCCAGT
GenBank Accession BX893101 [GenBank]
Graphic View Graphic view of gene At2g40620
Predicted Position of Insertion Chr2:16956916 - go to primer design
BLAST e Value 2e-20
Hit Clone Code (BAC ID) T2P4
Hit Gene Code At2g40620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Basic-leucine zipper (bZIP) transcription factor family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03