SimpleSearch - Line and FST details


Line specific information

 
Line ID 649D05
Vector Used pAC161
Line Availability only available from NASC (N462249)
Segregation Analysis 50:43:38
Confirmed for Hit At1g30810
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g30810

 
Sequence (A. th genome BLAST matches underlined)
>36-K023088-022-649-D05-8409
TGATGCGGATAGTGAAAGATATATCAGCCAGCTCTTGATCGTCCTATTTTAACACAGTTT
GAGAGTATCAACGGGCTTCAAATGTTTGGTTTCCTCTCACCCTCTATAGTTCAGGTAAGA
AATCTAAATCCAAGCCTTGTTCTTCTTCATTAAAAAGCTATTCATGATGTTAACTCTTAC
ACAACTTAACGCTTCTCTACAGGCCATTGAAGCTCTTGACCCAAACCATCGACTATGGGA
TCCTCCCTATAGTGAGACTAAGGAATCCTCCCTATATTGAGACTGCGTAAATCTACATTT
TCGAAAAGACATAAAATATAAAGGAAAAACCCATTATCAAAATCTCAGAAAACTTCAATA
ATCTTAACTAACAATTATTATTTAATAATAATTATAAGAACAACTATTACATCTAACAAA
ACAATCAATCTATTCATTGAAAAAAAATGACACATATATCAATACTCTCCCAACATTTAA
ACATTCAATAATAATATCACATATATACAT
GenBank Accession BX659969 [GenBank]
Graphic View Graphic view of gene At1g30810
Predicted Position of Insertion Chr1:10938489 - go to primer design
BLAST e Value 2e-106
Hit Clone Code (BAC ID) T17H7
Hit Gene Code At1g30810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transcription factor jumonji (jmj) family protein / zinc finger (C5HC2 type) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX659968 [GenBank] BX893684 [GenBank]

Gene hit At1g08110

 
Sequence (A. th genome BLAST matches underlined)
>36-K023273-022-649-D05-8409
GATGGTCGTTGTTTATCAATGTGGTCTGTTTCTTGACATATATATAATGAGCTATGGGAT
CCTCCCTATAATAAGGATAAGCAGGACCCCCTATTCCCCTTTTTTTTCCCTTCCCAAATG
GAAATGGCCCCCACCGCATTAATAGCCAGTATGATCTGCCCTCTCTAGAGGGAGCCTGCA
TTAATAGCCTGAAGGGGACACCCCCTCACACTACCACCTCCCCCCCCCACCCCCCCACCC
CCCCCCACCACTCCACACACTCTCATCTCCCTCCCCCACTCCCCCCCTTTTCCCCCCACC
CCCACCCCCCCACCCCCCAACCCCCCCACCCTCGCGCCTCTCCACACCACCACACCCCTC
CCCCCCACCACCTTCAAAGAAAACTCACCCCCAAGCGCCCTCCTCTACCCCCACCCAACC
ACAAAACGACCCTTCACAATCACACAACCACAAACCTCATCCCCTCCCCTCCACCCTC
GenBank Accession BX893685 [GenBank]
Graphic View Graphic view of gene At1g08110
Predicted Position of Insertion Chr1:2537810 - go to primer design
BLAST e Value 3e-22
Hit Clone Code (BAC ID) T6D22
Hit Gene Code At1g08110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation lactoylglutathione lyase family protein / glyoxalase I family protein
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03