SimpleSearch - Line and FST details


Line specific information

 
Line ID 649H07
Vector Used pAC161
Line Availability only available from NASC (N462299)
Segregation Analysis 50:48:34
Confirmed for Hit At1g23310
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g23310

 
Sequence (A. th genome BLAST matches underlined)
>56-K023088-022-649-H07-8409
TTCCGGAAGNAGCCATTTACATTGAATATATCCTGACACTTCTTACGGCATACTGACACT
TCTTGACGTTTTCATTCAGAGTATCGTAGTCTAATGCCTTGAGAGCCATTTATGTTCACT
CTGAACCAATCCCTATGGGATCCTCCCTATAGTGAGACTAAGGGAACCTCCCTATAATGG
GGCTGCGGACATCGACGTTTTCAAAGGGAGGGGGATATCAAAGTTTTCCAGACAAAAATG
TTTTTAAGGGAATCTTCCTTATAAGGGGATCCTGGCATTGGTGATTCAAGGGGATCCTCA
CAATTTTTGACTTTCAATCAATCAGTGATACTTAGCCAAAACCAAAAACAACATTAAAAA
ATAAACGTGCTCTCTTAGTCCACCTTCCACATTCATTCCAAACAATCTATCAATATACTT
CAATGCCGAGCAGAAATTCAGAACACTAACTATCGCTACTATACTTACACCATCCAGCTT
AATAATCACTATAAAAGACAAATAACTAATTTAATGTCACCTATATTAAACTGAATAGTT
CAATTA
GenBank Accession BX660029 [GenBank]
Graphic View Graphic view of gene At1g23310
Predicted Position of Insertion Chr1:8271261 - go to primer design
BLAST e Value 1e-46
Hit Clone Code (BAC ID) F26F24
Hit Gene Code At1g23310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glutamate:glyoxylate aminotransferase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR814098 [GenBank]


Last Updated on 07.07.2016 14:03