SimpleSearch - Line and FST details


Line specific information

 
Line ID 650B06
Vector Used pAC161
Line Availability only available from NASC (N462322)
Segregation Analysis 50:41:39
Confirmed for Hit At2g26150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F28N24

 
Sequence (A. th genome BLAST matches underlined)
>42-K021277-022-650-B06-8409
ATATAACCCAATGGAACAGATATCTTTATATGGTGATGCAAGGCGTTTAGCCTTAAGATT
TCGCGCTTCATGCAAAGTTTTGTGTTTGTAGTGTGCAACAGTATCCACGCTATATTGTAA
TACCAACACCTTTATGCATGTTGTAATTAAAATATCTACATATATAAAAGAGAATGGAAA
ATGCTAAAATGATTCGATAAATGATTTTTTTTTTCTTCTTAAAGGGATGTGACCCCTTAA
GGGAACCATAACCCCAACCATAATATGCAAAAATTAATGTAATTTTAACCCCTATGGGAC
CCCCCCTATAGT
GenBank Accession BX660059 [GenBank]
Graphic View Graphic view of sequence BX660059 of line 650B06
Predicted Position of Insertion Chr1:10232299 - go to primer design
BLAST e Value 3e-37
Hit Clone Code (BAC ID) F28N24
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g26150

 
Sequence (A. th genome BLAST matches underlined)
>42-K021296-022-650-B06-8409
ATTCGGAATNAGCCATTTACATTGAATATATCCTGAACACGAAAATGGAAGAACTGAAAG
TGGAAATGGAGGAAGAAACGGTGACGTTTACTGGTTCTGTAGCGGCTTCTTCATCTGTAG
GATCCTCTTCCTCTCCTATGGGATCCTCCCTATATTGAGATTGTTTATGCAATTATGGAG
GGGACTTGGTCTATGGGATCCTCCCTATAGTGAGATTTCCACAATGATACCACTAGGGGT
TTTTTTCAATTCAAAAATGTAGATGTCCCCACCCTTATTAAAAAACGACCTTTGGTTTCC
CTATGGGATACTGCTTAAGGTGCGTTCCTTCCTTTTCGACTATCTTCTATAAAAGGGGAC
AGATAGCTGAGCTATGTAATCCAAGGACGTTT
GenBank Accession BX660060 [GenBank]
Graphic View Graphic view of gene At2g26150
Predicted Position of Insertion Chr2:11135850 - go to primer design
BLAST e Value 1e-49
Hit Clone Code (BAC ID) T19L18
Hit Gene Code At2g26150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heat shock transcription factor A2
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40