SimpleSearch - Line and FST details


Line specific information

 
Line ID 650E07
Vector Used pAC161
Line Availability only available from NASC (N462359)
Segregation Analysis 50:41:39
Confirmed for Hit At5g47920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g47920

 
Sequence (A. th genome BLAST matches underlined)
>53-K021296-022-650-E07-8409
NAGCCATTTACAATTGAATATATCTGCGCGAGAGATCTGACCCTTTTTGATATCGCATTA
TAGTGTAGATCGGATGTATTTCGCTAAATGATTAGTTCATGTGTTAATGTTTGAAGATCC
CTGGGATCTTCCCTGTAGTCAGCCGATGTGATCCTCCCTATCGTGAGATTGTTGAGTTCC
TTGGCGAAGGCTACATCTATAGCCGTGAAGAACAAAACGAGTGCTTTCAAGACACGAGTA
CTCATGTTGTCTCTATGGGATCCTCCCTATAGTGAGANANNNNNGNNNNGNNNNNNTTTN
GTGTTNTTNNTNNNTTTTNNNTTTTGGTANTTTTNTNTTNTNTTAAAAGAAAATGGNATT
GTAAATGGGTTGAGGTGGGGNAAATTAATGGATTATTTGAATTTGAAAGTTTATATAGGG
GGAAAAGAAAGAAT
GenBank Accession BX660104 [GenBank]
Graphic View Graphic view of gene At5g47920
Predicted Position of Insertion Chr5:19404115 - go to primer design
BLAST e Value 1e-30
Hit Clone Code (BAC ID) MCA23
Hit Gene Code At5g47920 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23