SimpleSearch - Line and FST details


Line specific information

 
Line ID 650F10
Vector Used pAC161
Line Availability only available from NASC (N462374)
Segregation Analysis 100:99:83
Confirmed for Hit At5g26170
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g26170

 
Sequence (A. th genome BLAST matches underlined)
>78-K021277-022-650-F10-8409
CATTGAATAGTGGATCACGCATTCTTATAGGCGTAATTCGTAAATACTGGTGAGTATGAA
TGATGCAGACGACAAACTTGGGGAGTAGTTTCAGCGATGATACTCACTCTGTGTTCGAGT
TTCCGGAGCTATGGGATCCTCCCTATAGTGAGACCANTGCCCCCCTCCTTGCGTGGACCG
CCCTGGGCTGTTATGTCAAAAT
GenBank Accession BX660123 [GenBank]
Graphic View Graphic view of gene At5g26170
Predicted Position of Insertion Chr5:9148171 - go to primer design
BLAST e Value 6e-54
Hit Clone Code (BAC ID) T19G15
Hit Gene Code At5g26170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 50
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03