SimpleSearch - Line and FST details


Line specific information

 
Line ID 650G09
Vector Used pAC161
Line Availability only available from NASC (N462385)
Segregation Analysis 50:40:30
Confirmed for Hit At4g35620
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g35620

 
Sequence (A. th genome BLAST matches underlined)
>71-K021277-022-650-G09-8409
TTGAAGATTATGTTCGATGATCATTGGTAGACTCTGAAGTGAGGGATTTATAATTACAGA
AGAAGTTCTCTTACCATAACTTTTGGTAATACAACATTGTAGAATCTGAACTAACAGTGT
ACACCTGTGACCCAAAAAAAAACAACTGGCAAATCATTTGTTTGGTCTCAGCTCAATCAT
GCTCAGAGGAACAACCCCGGAATCCTCCCTAAGATGAGTCTCTATAGGTGCTAATGGCTA
AAAGAGACTTACAGGAGTTGATTCTCAGAGTACTGACAATGGAATTCACAAGTGCTGTTC
CATTCACTGAAGCCATGGATTGTACATTGAGCTGTGTACACGGCAGTGGCGGCGAGTAAC
GATGGTGCATACCGAACCATTTCGTAGTCCACAAGAGCAAGCTCAATCAAGAACGACGCC
GAGATCTCAAGCTGTTTCCAAAACAAGATTAGTTTGGAATTCCCAATCCATTTAGATTAT
TCGGTACATTG
GenBank Accession BX660137 [GenBank]
Graphic View Graphic view of gene At4g35620
Predicted Position of Insertion Chr4:16903806 - go to primer design
BLAST e Value 4e-129
Hit Clone Code (BAC ID) F8D20
Hit Gene Code At4g35620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclin B2;2
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03