SimpleSearch - Line and FST details


Line specific information

 
Line ID 651G08
Vector Used pAC161
Line Availability only available from NASC (N462480)
Segregation Analysis 50:49:50
Confirmed for Hit At1g63430
Parent of DUPLO pair 2461
Parent of pair(s) none

Gene hit At1g63430

 
Sequence (A. th genome BLAST matches underlined)
>63-K021264-022-651-G08-8409
ATTGAATATTGAATATTCTATGGACAACCTCGCGTATAGTGAGTTCTTTATTATTCTGAA
TTCCTATGGGATCCTTGCTATAGTTGAGACAAATAGGATCCCCCGTTTTCTATCGTTTAT
GCTGTCTTTTGGAACTCTCTAAGTCTTCAATTTATTCGTAAAAATGCTCTTTTGTGGTAA
CTATGGGATCCTCCTTGGGTGGGGTTTAAAGGTCACCCCATTTTTGATCTACCTCTGTCC
GAACTCTTAATTTGCACGCGCCTAAGTTGACGTCTAACTGGGGGCTCCCAGATATCTTTA
TCTCAACATGTCAACGATCTCGTACACGCGGAAAATCAGAATTACCTTTTAATCGGAATA
ATGAGGTTCCCAAAATGACACAAATGTTAGAATACCCAAAATGAAAGTACCTTTTGATAA
AACAACCAAATACTTTCCGTTGTATTTTCACGCTAAGACAATTTAGATTTTATTCTAATT
CGGAGAGCATTAATTCGACGTGTCAACATTCATGTCCACACGGGAAAC
GenBank Accession BX660256 [GenBank]
Graphic View Graphic view of gene At1g63430
Predicted Position of Insertion Chr1:23524264 - go to primer design
BLAST e Value 4e-21
Hit Clone Code (BAC ID) F2K11
Hit Gene Code At1g63430 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich repeat protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23