SimpleSearch - Line and FST details


Line specific information

 
Line ID 652H12
Vector Used pAC161
Line Availability only available from NASC (N462592)
Segregation Analysis 50:49:44
Confirmed for Hit At1g47550
Parent of DUPLO pair none
Parent of pair(s) 12147

Gene hit At1g47550

 
Sequence (A. th genome BLAST matches underlined)
>96-K023205-022-652-H12-8409
GCAATAAGCCATTTACATTGAATATATTCCGATAATGTTAGGACTATCAGCTGTTCATGG
CTCTCGAACTTGATAAAAAAATCCTTCTGTATATGGACGCACGATAACGCATTGTATTCA
AACATTGACCTAAAAAAGCACTGTTATTTATTACTCTCTTCAACTTTTCAGGTTACACTG
ATAGCTTGAATTTATCACAAAACCATGGTAGCAACTCCTCTGATGCTATGGGATCCTCCC
TATAGTGAGCCGATTATGTCACGCCTTTCTCTCTCTTTTCTCTCTTAATATTTTAGAGAG
CGGAAGTCTTCTCTGA
GenBank Accession BX893765 [GenBank]
Graphic View Graphic view of gene At1g47550
Predicted Position of Insertion Chr1:17463830 - go to primer design
BLAST e Value 5e-30
Hit Clone Code (BAC ID) F16N3
Hit Gene Code At1g47550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst complex component sec3A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX893764 [GenBank]

Gene hit At3g62190

 
Sequence (A. th genome BLAST matches underlined)
>96-K022838-022-652-H12-8409
NNNAAGCTTAATTCCGGACATAAGCCATTTACATTGAATATATCCGGATAATGTTTGGAC
TACCAGGTGCGCGTGGCTCTCGCACTTGACCGAAAACTCCATCTGTATATGGTCGCACAA
CGACGCATTGTATTCAAACACTGAGCTAATAAAGCACTGTTATTTATTACTCTCTTCTAC
TTTTCAGTTTACACTGATACCTTGCATTTATCCCAAAATCATGCTATCATCTCCTCTGAT
GCTATGGGATCCTCCCTATAGATGACTAGTATTACTCACGACTTTCTCTCTCTTTTCTCT
CTTAATATTTTATATAGAGAAAATCTTCTCTGATGCTCCCATTTGATTCTATTAATGACC
TATTTCCTCATAGAATGTCGTAAATGATTTGAGAACTTTCTTCTAAACTCTAAATATCAT
TTTCTTTTTAATCTAAAAAATGTAATATCATTTTGTCATCATCAACTAAAATATTACACA
ACCGTTTAACCCGAAAATTAACGCCCAATTCACTCCCTACCATATGTAATTATTA
GenBank Accession BX660332 [GenBank]
Graphic View Graphic view of gene At3g62190
Predicted Position of Insertion Chr3:23021113 - go to primer design
BLAST e Value 2e-85
Hit Clone Code (BAC ID) T17J13
Hit Gene Code At3g62190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chaperone DnaJ-domain superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40