SimpleSearch - Line and FST details


Line specific information

 
Line ID 653B01
Vector Used pAC161
Line Availability only available from NASC (N462605)
Segregation Analysis 50:50:34
Confirmed for Hit At2g30040
Parent of DUPLO pair 2555
Parent of pair(s) none

Gene hit At2g30040

 
Sequence (A. th genome BLAST matches underlined)
>32-K118413-0022-653-B01C-8409
ATTTCATTGAATATATCCTGAAGCCATTTACATGTAGAATTGAAGGGTAGAATTGGAATC
TTACATATCATTGGAGTCGTCAAGCGATGATTCCGTAAGACAACCGAGGAATGAAGAGTC
GGCGACGGAGTTGGCGTCGGCAGTGACGTGTGAAGCAATATTGTTGGTGATGATATTGGT
GGTAGAGAATATTCAAATATATGCCACGTTTTACACCAGTAGTATTATTATGCATATTCT
ATATTGTTGTAGTTGTTGTTGTTATTATCATTATCAAAACAATAATAAGAAGAATAATTT
TTCGAAATCTACATCTTTCATTCTCAGCCTTAACTTTTTGTTTGGTATTGCATGTGATTC
GGATCGGTCTATCTATTAACATAAAAACTCTTTTACGTGAGTGTCCTTAACTCTCAATTG
TTACCTCCTTTTTTGTTGATAACTCTCATTTAACACACCCNGTTTTTGGTTTGATAGCTT
CTTATTGGACCATACATTATAGAGTAAAATATTTAAGTTCGTTAGAGAGGAACTAAGACC
ATGTAATTAAGTATAGTTAGGCTGATAAAGTATATGGTTAGTGTCACGTTGAAGTTG
GenBank Accession HG969075 [GenBank]
Graphic View Graphic view of gene At2g30040
Predicted Position of Insertion Chr2:12822802 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F23F1
Hit Gene Code At2g30040 [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase kinase kinase 14
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23