SimpleSearch - Line and FST details


Line specific information

 
Line ID 654A12
Vector Used pGABI1
Line Availability only available from NASC (N462700)
Segregation Analysis 50:50:45
Confirmed for Hit At1g45688
Parent of DUPLO pair 2508
Parent of pair(s) none

Gene hit At1g45688

 
Sequence (A. th genome BLAST matches underlined)
>89-K021351-022-654-A12-8409
TGAAGCATTTACATTGAATAATCCTGCCACCACCAGATATCAGTTCCCACCTACCAGCAT
CTTGACCAGCTTGGATCTTAAGCGTCTCCTATGTTATACTCTGCAAATTCCAATCACCAA
AACCTAAATCATCAAATCTAAATTTGGAAATTCAGAGATCTGAATTGACTTCAAATCAAC
GAGTGTCTACTTCCAAATTTCTTTAAAGATCTACTAAATTCAAGCTCGAATTAAGCTAAC
TAGAAGTAGAAACACCAATCTAATTTCAAGATCTGAATCAACTTTACTAAAATTGAAGGA
AGAATTTGAATCTAACCTTGACAGTGATCTTAGGTTTCATAGGTTTAGCAGCACCATAGA
GAATCAAAGAGAAGAAACCAAAGAGAATAAAGAATCCAACGATAAAAGCCAAAACATAGC
AACGACGAGGAACACCACCGTCTCTATCACCATCATCTAACAAACCTTCTTCTTCAATAA
CCGCACATTCTTTCCACTGTTTCTCACCGCCGTGACCTT
GenBank Accession BX660406 [GenBank]
Graphic View Graphic view of gene At1g45688
Predicted Position of Insertion Chr1:17192277 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F2G19
Hit Gene Code At1g45688 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03