SimpleSearch - Line and FST details


Line specific information

 
Line ID 654H06
Vector Used pGABI1
Line Availability only available from NASC (N462778)
Segregation Analysis 50:49:38
Confirmed for Hit At1g73460
Parent of DUPLO pair none
Parent of pair(s) 44782, 85530

Gene hit T13J10

 
Sequence (A. th genome BLAST matches underlined)
>48-K021351-022-654-H06-8409
ACTTGGAAGAGAGTATGGGATCCTCCCTATAGTGAGATATTTNCGACATTCTAACTACCT
TGAGATTCAGGTCCAATCCCTTTTTGATGATCGTTATGATCTTTATACAGACATCCTTTC
CTGTCTGCAAATCATGCCCTTGTACGTCTTTACTGAAAGCTGCTGATCCTCTTTACGGTA
TCCTCCCTATAGTGAGATTTATCCTTAACCAGTCTTCAATATTGCTTTCACTTTCCCCCG
ACGAGCGCGGTAAATTTAACACCGCACTTAGACTAAACTCTTCTTGATACAAAACCACCC
CACGCATATACTCTAAACACTGAACCAGAATCTCTCTCTGACCACTGTGATACCAAGAAG
AATAAACACCCCTCATAAACCGGAATCCTCATTAAAGTATTTATACCTAAAAGAAATTGA
CTCTTTTTGATTTTCT
GenBank Accession FR814165 [GenBank]
Graphic View Graphic view of sequence FR814165 of line 654H06
Predicted Position of Insertion Chr3:11494759 - go to primer design
BLAST e Value 7e-26
Hit Clone Code (BAC ID) T13J10
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g73460

 
Sequence (A. th genome BLAST matches underlined)
>48-K021385-022-654-H06-8409
CCATTTACATTGAAATATCCATCGAGGAACATGCTTGTTGACATACTTCAAAAGTTTTAT
CTCGTCAAGACTCTGGTCAAAAAAGTCTTTGTTGTTCTTTATGATCTTTATACAGACATC
CATTCCTGTCTGTAAGTCATGCGCTTGTATGGCTTTACTGAAGGCTGCTGATCCAAGGTA
TGGGATCCTCCCTATAGTGAG
GenBank Accession BX660505 [GenBank]
Graphic View Graphic view of gene At1g73460
Predicted Position of Insertion Chr1:27623571 - go to primer design
BLAST e Value 9e-81
Hit Clone Code (BAC ID) T9L24
Hit Gene Code At1g73460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03